miRBase entry: dme-mir-2a-2

Stem-loop dme-mir-2a-2


Accession
MI0000118
Description
Drosophila melanogaster dme-mir-2a-2 precursor miRNA

Literature search
32 open access papers mention dme-mir-2a-2
(194 sentences)

Sequence

678575 reads, 14972 reads per million, 49 experiments
aucuaagCCUCAUCAAGUGGUUGUGAUAuggauacccaacgcaUAUCACAGCCAGCUUUGAUGAGCuaggau
((((.(((.(((((((((((((((((((((...........)))))))))))))..))))))))))).))))

Structure
    a   C        --             gaua 
aucu agC UCAUCAAG  UGGUUGUGAUAug    c
|||| ||| ||||||||  |||||||||||||    c
uagg uCG AGUAGUUU  ACCGACACUAUac    c
    a   -        CG             gcaa 


Annotation confidence High
Do you think this miRNA is real?
Comments
Stark et al. [2] have identified targets for miR-2 in Drosophila using computational prediction followed by experimental validation. miR-2 regulates the proapoptotic genes reaper, grim and sickle, suggesting that it may be involved in the control of apoptosis.

Genome context
chr2L: 19569490-19569561 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from dme-mir-2a-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dme-miR-2a-3p

Accession MIMAT0000106
Description Drosophila melanogaster dme-miR-2a-3p mature miRNA
Sequence 44 - UAUCACAGCCAGCUUUGAUGAGC - 66
Evidence experimental
cloned [1,4], Northern [1,3], 454 [5-6], Illumina [6]
Database links

Mature dme-miR-2a-2-5p

Accession MIMAT0020781
Description Drosophila melanogaster dme-miR-2a-2-5p mature miRNA
Sequence 8 - CCUCAUCAAGUGGUUGUGAUA - 28
Evidence not_experimental
Database links

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 12812784
    Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity
    "Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V"
    "Dev Biol (2003) 259:9-18

  3. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  4. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  5. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879

  6. PubMed ID: 14691535
    Identification of Drosophila MicroRNA targets
    "Stark A, Brennecke J, Russell RB, Cohen SM"
    "PLoS Biol (2003) 1:E60