dme-mir-2b is a member of the miR-2 family in Drosophila, and it shares the same mature sequence with dme-mir-2b-1 and dme-mir-2b-2, but is one nucleotide longer than the miRBase annotated sequences [PMC3268580]. The roles and functions of dme-mir-2b in Drosophila are not yet clear [PMC9100521]. Overexpression of dme-mir-2b, along with dme-mir-184 and dme-mir-274, resulted in almost total lethality during embryogenesis/development [PMC9100521]. Overexpression of dme-mir-2b specifically led to a similar outcome [PMC9100521]. Seven miRNAs, including dme-mir-2b, were found to be differentially expressed between long and short photoperiods [PMC9100521'>PMC9100521'>PMC9100521]. The overexpression of dme-mir-2b, along with other miRNAs, using UAS transgenes driven by Act-Gal4 or pdf-Gal4 resulted in changes in photoperiodic diapause [PMC9100521]. The microarray experiments indicated that both dme-mir-2b and dme-mir274 are expressed at higher levels in long days compared to short days [PMC9100521]. References: [PMC3268580] - Marco A. Mendoza-Mendoza et al. (2013) Evolutionary Conservation of microRNA Regulatory Circuits: An Examination of microRNA Gene Complexity and Clustering in Mammals, Fishes, Xenopus ,and Caenorhabditis elegans. PLoS ONE 8(6): e66415. [PMC9100521] - Hui Zhang et al. (2020) Identification and Functional Analysis of Differentially Expressed miRNAs in the Photoperiodic Diapause of the Onion Fly, Delia antiqua. Frontiers in Physiology 11: 573.
a - A --uuu cuu uuguguc UUCUUCAAAG UGGUUGUGA AUG gc u ||||||| |||||||||| ||||||||| ||| || agcgcag GAGGAGUUUC ACCGACACU Uac cg u C G A uuauc uau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0000107 |
Description | Drosophila melanogaster dme-miR-2b-3p mature miRNA |
Sequence | 54 - UAUCACAGCCAGCUUUGAGGAGC - 76 |
Evidence |
experimental
cloned [1,4], Northern [1,3], 454 [5-6], Illumina [6] |
Database links | |
Predicted targets |
Accession | MIMAT0020783 |
Description | Drosophila melanogaster dme-miR-2b-2-5p mature miRNA |
Sequence | 9 - UUCUUCAAAGUGGUUGUGAAAUG - 31 |
Evidence | not_experimental |
Database links |
|