Accession
MI0000127
Description
Drosophila melanogaster
dme-mir-7 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Dme-mir-7 is a specific miRNA assay control for Drosophila melanogaster (D. melanogaster) [PMC6224079]. It was used in a pilot run to confirm the absence of plant/insect miRNA contamination and unspecific amplifications in serum samples [PMC6224079]. Dme-mir-7 was also included in a Taqman Low-Density Array (TLDA) card for qPCR analysis of mature human miRNAs [PMC6224079]. In a study comparing different miRNAs, dme-mir-7 was found to have 5325 recovered regions, with the SBM method returning 28 [PMC2365947]. The dme-mir-7 results showed an average of 273 sequences scoring equal to or better than the left-out sequences and an average of 8868 sequences scoring at least as high as the validated target using miRanda [PMC2365947]. In another study, dme-mir-7 was used as a spike-in RNA for RNA isolation and reverse transcription in serum samples [PMC8615628]. It was also found to be significantly down-regulated in SSc-A-MSCs compared to HC-A-MSCs, with a fold change less than 0.5 [PMC6509164]. The cDNA synthesized from total RNA using dme-mir-7 RT-primer was used for TaqMan MicroRNA Assay analysis [PMC4273950].
Literature search
31 open access papers mention dme-mir-7
(265 sentences)
(265 sentences)
Sequence
501109
reads,
4215
reads per million, 49 experiments
gagugcauuccguaUGGAAGACUAGUGAUUUUGUUGUuuggucuuugguaauaaCAAUAAAUCCCUUGUCUUCUUAcggcgugcauuu
((((((((.(((((.(((((((.((.(((((.((((((....(....)....))))))))))).)).)))))))))))).))))))))
((((((((.(((((.(((((((.((.(((((.((((((....(....)....))))))))))).)).)))))))))))).))))))))
Structure
u U U U U uggu u
gagugcau ccgua GGAAGAC AG GAUUU GUUGUu c u
|||||||| ||||| ||||||| || ||||| |||||| |
uuuacgug ggcAU UCUUCUG UC CUAAA UAACaa g u
c - U C - uaau g
Annotation confidence
High
Do you think this miRNA is real?
Comments
Stark et al. [2] have identified targets for miR-7 in Drosophila using computational prediction followed by experimental validation. miR-7 regulates a family of Notch targets including the Enhancer of split and Bearded complex genes Tom and m4, and the basic helix-loop-helix transcriptional repressors HLHm3 and hairy.
Genome context
chr2R: 20606067-20606154 [+]
Database links
Mature dme-miR-7-5p
| Accession | MIMAT0000112 |
| Description | Drosophila melanogaster dme-miR-7-5p mature miRNA |
| Sequence | 15 - UGGAAGACUAGUGAUUUUGUUGU - 37 |
| Evidence |
experimental
cloned [1,4], Northern [1,3-4], 454 [5-6], Illumina [6] |
| Database links |
|
| Predicted targets |
|
Mature dme-miR-7-3p
| Accession | MIMAT0020790 |
| Description | Drosophila melanogaster dme-miR-7-3p mature miRNA |
| Sequence | 55 - CAAUAAAUCCCUUGUCUUCUUA - 76 |
| Evidence | not_experimental |
| Database links |
|
References
|
