miRBase entry: dme-mir-7

Stem-loop dme-mir-7


Accession
MI0000127
Description
Drosophila melanogaster dme-mir-7 precursor miRNA

Literature search
154 open access papers mention dme-mir-7
(625 sentences)

Sequence

520794 reads, 4359.0 reads per million, 51 experiments
gagugcauuccguaUGGAAGACUAGUGAUUUUGUUGUuuggucuuugguaauaaCAAUAAAUCCCUUGUCUUCUUAcggcgugcauuu
((((((((.(((((.(((((((.((.(((((.((((((....(....)....))))))))))).)).)))))))))))).))))))))

Structure
        u     U       U  U     U      uggu u 
gagugcau ccgua GGAAGAC AG GAUUU GUUGUu    c u
|||||||| ||||| ||||||| || ||||| ||||||    |  
uuuacgug ggcAU UCUUCUG UC CUAAA UAACaa    g u
        c     -       U  C     -      uaau g 


Annotation confidence High
Do you think this miRNA is real?
Comments
Stark et al. [2] have identified targets for miR-7 in Drosophila using computational prediction followed by experimental validation. miR-7 regulates a family of Notch targets including the Enhancer of split and Bearded complex genes Tom and m4, and the basic helix-loop-helix transcriptional repressors HLHm3 and hairy.

Genome context
chr2R: 20606067-20606154 [+]

Database links

Mature dme-miR-7-5p

Accession MIMAT0000112
Description Drosophila melanogaster dme-miR-7-5p mature miRNA
Sequence 15 - UGGAAGACUAGUGAUUUUGUUGU - 37
Evidence experimental
cloned [1,4], Northern [1,3-4], 454 [5-6], Illumina [6]
Database links
Predicted targets

Mature dme-miR-7-3p

Accession MIMAT0020790
Description Drosophila melanogaster dme-miR-7-3p mature miRNA
Sequence 55 - CAAUAAAUCCCUUGUCUUCUUA - 76
Evidence not_experimental
Database links

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 12812784
    Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity
    "Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V"
    "Dev Biol (2003) 259:9-18

  3. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  4. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  5. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879

  6. PubMed ID: 14691535
    Identification of Drosophila MicroRNA targets
    "Stark A, Brennecke J, Russell RB, Cohen SM"
    "PLoS Biol (2003) 1:E60