miRBase entry: mmu-let-7g

Stem-loop mmu-let-7g


Accession
MI0000137
Symbol
MGI: Mirlet7g
Description
Mus musculus mmu-let-7g precursor miRNA

Literature search
414 open access papers mention mmu-let-7g
(2324 sentences)

Sequence

7787580 reads, 17749 reads per million, 107 experiments
ccaggcUGAGGUAGUAGUUUGUACAGUUugagggucuaugauaccacccgguacaggagauaACUGUACAGGCCACUGCCUUGCcagg
((.(((.((((((((.((((((((((((.....((((.((.((((....))))))..)))))))))))))))).))))))))))).))

Structure
  a   U        A            ugagg    -a  a    a 
cc ggc GAGGUAGU GUUUGUACAGUU     gucu  ug uacc c
|| ||| |||||||| ||||||||||||     ||||  || ||||  
gg cCG UUCCGUCA CGGACAUGUCAa     uaga  ac augg c
  a   -        C            -----    gg  -    c 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence reported in [1] has a 3' terminal A residue, which is incompatible with the reported precursor sequence from [1] and in this entry. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr9: 106178840-106178927 [+]

Database links

Mature mmu-let-7g-5p

Accession MIMAT0000121
Description Mus musculus mmu-let-7g-5p mature miRNA
Sequence 7 - UGAGGUAGUAGUUUGUACAGUU - 28
Evidence experimental
cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-let-7g-3p

Accession MIMAT0004519
Description Mus musculus mmu-let-7g-3p mature miRNA
Sequence 63 - ACUGUACAGGCCACUGCCUUGC - 84
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009