miRBase entry: mmu-let-7i

Stem-loop mmu-let-7i


Accession
MI0000138
Symbol
MGI: Mirlet7i
Description
Mus musculus mmu-let-7i precursor miRNA

Literature search
425 open access papers mention mmu-let-7i
(2189 sentences)

Sequence

6203427 reads, 16255 reads per million, 107 experiments
cuggcUGAGGUAGUAGUUUGUGCUGUUggucggguugugacauugcccgcuguggagauaaCUGCGCAAGCUACUGCCUUGCUag
(((((.(((((((((((((((((.(((((.(((((.........)))))))........))).))))))))))))))))))))))

Structure
     U                 U   --------  u     ugu 
cuggc GAGGUAGUAGUUUGUGC GUU        gg cgggu   g
||||| ||||||||||||||||| |||        || |||||   a
gaUCG UUCCGUCAUCGAACGCG Caa        uc gcccg   c
     -                 U   uagaggug  -     uua 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr10: 122985640-122985724 [-]

Database links

Mature mmu-let-7i-5p

Accession MIMAT0000122
Description Mus musculus mmu-let-7i-5p mature miRNA
Sequence 6 - UGAGGUAGUAGUUUGUGCUGUU - 27
Evidence experimental
cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-let-7i-3p

Accession MIMAT0004520
Description Mus musculus mmu-let-7i-3p mature miRNA
Sequence 62 - CUGCGCAAGCUACUGCCUUGCU - 83
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009