miRBase entry: mmu-mir-127

Stem-loop mmu-mir-127


Accession
MI0000154
Symbol
MGI: Mir127
Description
Mus musculus mmu-mir-127 precursor miRNA mir-127
Gene
family?
RF00676; mir-127

Literature search
64 open access papers mention mmu-mir-127
(613 sentences)

Sequence

3442234 reads, 5576 reads per million, 100 experiments
ccagccugCUGAAGCUCAGAGGGCUCUGAUucagaaagaucaUCGGAUCCGUCUGAGCUUGGCUggucgg
((((((.....(((((((((.((.((((((((.....))..)))))).)).)))))))))))))))....

Structure
----      ugCUG         G  C      --  a 
    ccagcc     AAGCUCAGA GG UCUGAU  uc g
    ||||||     ||||||||| || ||||||  || a
    ggUCGG     UUCGAGUCU CC AGGCUa  ag a
ggcu      -----         G  U      cu  a 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [6].

Genome context
chr12: 109592846-109592915 [+]
Clustered miRNAs
12 other miRNAs are < 10 kb from mmu-mir-127
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-127-5p

Accession MIMAT0004530
Description Mus musculus mmu-miR-127-5p mature miRNA
Sequence 9 - CUGAAGCUCAGAGGGCUCUGAU - 30
Evidence experimental
cloned [6], Illumina [7-8]
Database links
Predicted targets

Mature mmu-miR-127-3p

Accession MIMAT0000139
Description Mus musculus mmu-miR-127-3p mature miRNA
Sequence 43 - UCGGAUCCGUCUGAGCUUGGCU - 64
Evidence experimental
cloned [1,3,5-6], PCR [4], Illumina [7-8]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  5. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  6. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  7. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  8. PubMed ID: 15854907
    RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus
    "Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C"
    "Curr Biol (2005) 15:743-749