miRBase entry: mmu-mir-134

Stem-loop mmu-mir-134


Accession
MI0000160
Symbol
MGI: Mir134
Description
Mus musculus mmu-mir-134 precursor miRNA mir-134
Gene
family?
RF00699; mir-134

Literature search
79 open access papers mention mmu-mir-134
(342 sentences)

Sequence

186746 reads, 435 reads per million, 89 experiments
agggugUGUGACUGGUUGACCAGAGGGGcgugcacucuguucaccCUGUGGGCCACCUAGUCACCaacccu
(((((..((((((((.((.(((.((((..(.(((...))).).)))).)))..)).))))))))..)))))

Structure
     gU        U  -A   G    Gc u   c 
agggu  GUGACUGG UG  CCA AGGG  g gca  
|||||  |||||||| ||  ||| ||||  | ||| u
uccca  CACUGAUC AC  GGU UCcc  c ugu  
     aC        C  CG   G    -a u   c 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr12: 109734139-109734209 [+]
Clustered miRNAs
17 other miRNAs are < 10 kb from mmu-mir-134
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-134-5p

Accession MIMAT0000146
Description Mus musculus mmu-miR-134-5p mature miRNA
Sequence 7 - UGUGACUGGUUGACCAGAGGGG - 28
Evidence experimental
cloned [1,3-4], PCR [2], Illumina [5,7]
Database links
Predicted targets

Mature mmu-miR-134-3p

Accession MIMAT0016985
Description Mus musculus mmu-miR-134-3p mature miRNA
Sequence 46 - CUGUGGGCCACCUAGUCACC - 65
Evidence experimental
454 [6], Illumina [7]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275

  7. PubMed ID: 15310658
    A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
    "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
    "Genome Res (2004) 14:1741-1748