Stem-loop ath-MIR156e

Accession

MI0000182

Description

Arabidopsis thaliana ath-MIR156e precursor miRNA

Literature search

78 open access papers mention ath-MIR156e
(768 sentences)

Sequence

aggaggUGACAGAAGAGAGUGAGCACacauggugguuucuugcaugcuuuuuugauuaggguuucaugcuugaagcuaugugugcuuacucucucucugucaccccu
(((.(((((((((((((((((((((((((((((...(((..(((((((((.......))))...)))))..))))))))))))))))))))))).))))))))))))

Structure

   a         -                    ggu   uu     ---    uu 
agg ggUGACAGA AGAGAGUGAGCACacauggu   uuc  gcaug   cuuu  u
||| ||||||||| ||||||||||||||||||||   |||  |||||   ||||  g
ucc ccacugucu ucucucauucguguguaucg   aag  cguac   ggga  a
   -         c                    ---   uu     uuu    uu 

Annotation confidence Not enough data

Comments

MIR156e is thought to target 10 mRNAs coding for proteins containing the Squamosa-promoter Binding Protein (SBP) box [1]. The complementary sites are downstream of this conserved domain, within a poorly conserved protein-coding context or the 3' UTR [2].

Genome context

chr5: 3867207-3867313 [+]

Mature ath-miR156e

• Accession: MIMAT0000170
• Description: Arabidopsis thaliana ath-miR156e mature miRNA
• Sequence: 7 - UGACAGAAGAGAGUGAGCAC - 26
• Evidence: experimental ; cloned [1,3], Northern [1], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

1. PubMed ID: 12101121
   MicroRNAs in plants
   "Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP"
   "Genes Dev (2002) 16:1616-1626


2. PubMed ID: 12202040
   Prediction of plant microRNA targets
   "Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP"
   "Cell (2002) 110:513-520


3. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


4. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


5. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


6. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177