miRBase entry: ath-MIR166g

Stem-loop ath-MIR166g


Accession
MI0000207
Description
Arabidopsis thaliana ath-MIR166g precursor miRNA
Gene family
MIPF0000004; MIR166

Literature search
39 open access papers mention ath-MIR166g
(313 sentences)

Sequence

gcgauuuaggguuuagaggaauguuguuuggcucgaggucauggagaguaauucguuaacccaacucaaaacucuaaaugauucUCGGACCAGGCUUCAUUCCCCucaaccuauuuuaucgc
(((((...(((((.((.((((((..((((((.((((((((((..(((((.....(((.....))).....)))))..)))).)))))).))))))..)))))).)).))))).....)))))

Structure
     --uua     u  a      uu      c      -    gg     aauuc   a 
gcgau     ggguu ag ggaaug  guuugg ucgagg ucau  agagu     guu a
|||||     ||||| || ||||||  |||||| |||||| ||||  |||||     ||| c
cgcua     uccaa uC CCUUAC  CGGACC GGCUcu agua  ucuca     caa c
     uuuua     c  C      UU      A      u    aa     aaacu   c 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
MIR166g, like miR165, is thought to target mRNAs coding for HD-Zip transcription factors including Phabulosa (PHB) and Phavoluta (PHV) that regulate axillary meristem initiation and leaf development [2].

Genome context
chr5: 25504798-25504919 [+]

Database links

Mature ath-miR166g

Accession MIMAT0000195
Description Arabidopsis thaliana ath-miR166g mature miRNA
Sequence 85 - UCGGACCAGGCUUCAUUCCCC - 105
Evidence experimental
cloned [1], Northern [1], 454 [3-4], MPSS [3], Illumina [5]

References

  1. PubMed ID: 12101121
    MicroRNAs in plants
    "Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP"
    "Genes Dev (2002) 16:1616-1626

  2. PubMed ID: 12202040
    Prediction of plant microRNA targets
    "Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP"
    "Cell (2002) 110:513-520

  3. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  4. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  5. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177