Stem-loop ath-MIR159b

Accession

MI0000218

Description

Arabidopsis thaliana ath-MIR159b precursor miRNA

Literature search

53 open access papers mention ath-MIR159b
(449 sentences)

Sequence

56486046 reads, 134449.0 reads per million, 185 experiments

ggaaGAGCUCCUUGAAGUUCAAUGGAggguuuagcagggugaaguaaAGCUGCUAAGCUAUGGAUCCCauaagccuuaucaaauucaauauaauugaugauaagguuuuuuuuauggAUGCCAUAUCUCAGGAGCUUUcacuuaccccuuuaauggcuucacucuuCUUUGGAUUGAAGGGAGCUCUUcaucucuc
.((((((((((((..(((((((.(((((((..(((((((..((((((((((.((.((.(((((...(((((((((((((((...(((((...)))))))))))))).....))))))...))))).)).)).)))))).))))..))))......)))..))))))).)))))))..)))))))))))).......

Structure

------g            GA       U       uu   ------    ug    -      G  A  C     AUC      -----         aau     a 
       gaaGAGCUCCUU  AGUUCAA GGAgggu  agc      aggg  aagu aaAGCU CU AG UAUGG   CCauaa     gccuuauca   ucaau  
       ||||||||||||  ||||||| |||||||  |||      ||||  |||| |||||| || || |||||   ||||||     |||||||||   ||||| u
       cUUCUCGAGGGA  UUAGGUU Cuucuca  ucg      uccc  uuca UUUCGA GA UC AUACC   gguauu     uggaauagu   aguua  
cucucua            AG       U       cu   guaauu    ca    c      G  C  U     GUA      uuuuu         ---     a 

Annotation confidence High

Comments

Reference [1] described the discovery of MIR159b, but referred to the sequence by the internal identifier MIR40b. This sequence is not related to C. elegans miR-40. MIR159b is found on chromosome 1 in Arabidopsis thaliana [2] and is thought to target mRNAs coding for MYB proteins which are known to bind to the promoter of the floral meristem identity gene LEAFY [3].

Genome context

chr1: 6220646-6220841 [+]

Mature ath-miR159b-5p.1

• Accession: MIMAT0031889
• Description: Arabidopsis thaliana ath-miR159b-5p.1 mature miRNA
• Sequence: 5 - GAGCUCCUUGAAGUUCAAUGGA - 26
• Evidence: not_experimental

Mature ath-miR159b-5p.2

• Accession: MIMAT0060843
• Description: Arabidopsis thaliana ath-miR159b-5p.2 mature miRNA
• Sequence: 48 - AGCUGCUAAGCUAUGGAUCCC - 68
• Evidence: experimental ; Illumina [1]

Mature ath-miR159b-3p.1

• Accession: MIMAT0000207
• Description: Arabidopsis thaliana ath-miR159b-3p.1 mature miRNA
• Sequence: 167 - CUUUGGAUUGAAGGGAGCUCUU - 188
• Evidence: experimental ; cloned [1-2,4], 5'RACE [4], 454 [5-6], MPSS [5], Illumina [7]

Mature ath-miR159b-3p.2

• Accession: MIMAT0060842
• Description: Arabidopsis thaliana ath-miR159b-3p.2 mature miRNA
• Sequence: 118 - AUGCCAUAUCUCAGGAGCUUU - 138
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 12202040
   Prediction of plant microRNA targets
   "Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP"
   "Cell (2002) 110:513-520


2. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


3. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


4. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


5. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


6. PubMed ID: 12226481
   Short RNAs can identify new candidate transposable element families in Arabidopsis
   "Mette MF, van der Winden J, Matzke M, Matzke AJ"
   "Plant Physiol (2002) 130:6-9


7. PubMed ID: 12225663
   CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana
   "Park W, Li J, Song R, Messing J, Chen X"
   "Curr Biol (2002) 12:1484-1495