miRBase entry: mmu-mir-182

Stem-loop mmu-mir-182


Accession
MI0000224
Symbol
MGI: Mir182
Description
Mus musculus mmu-mir-182 precursor miRNA mir-182
Gene
family?
RF00702; mir-182

Literature search
131 open access papers mention mmu-mir-182
(949 sentences)

Sequence

726722 reads, 1100 reads per million, 103 experiments
accauuUUUGGCAAUGGUAGAACUCACACCGguaagguaaugggacccgGUGGUUCUAGACUUGCCAACUauggu
(((((..(((((((...((((((...((((((..............))))))))))))...)))))))..)))))

Structure
     uU       UGG      UCA      uaaggu 
accau  UUGGCAA   UAGAAC   CACCGg      a
|||||  |||||||   ||||||   ||||||       
uggua  AACCGUU   AUCUUG   GUGgcc      a
     UC       CAG      ---      cagggu 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr6: 30165918-30165992 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-182
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-182-5p

Accession MIMAT0000211
Description Mus musculus mmu-miR-182-5p mature miRNA
Sequence 7 - UUUGGCAAUGGUAGAACUCACACCG - 31
Evidence experimental
cloned [1-3], Illumina [4,6]
Database links
Predicted targets

Mature mmu-miR-182-3p

Accession MIMAT0016995
Description Mus musculus mmu-miR-182-3p mature miRNA
Sequence 50 - GUGGUUCUAGACUUGCCAACU - 70
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275