Mmu-mir-190 is a microRNA that was found to be significantly downregulated in the corneal endothelium of old mice compared to young mice [PMC3742134]. The expression of mmu-mir-190 was decreased by 37.1±2.78-fold in old mice [PMC3742134]. The miRNA-mRNA regulatory network analysis revealed that mmu-mir-190 is associated with brain-derived neurotrophic factor (BDNF) [PMC3742134]. In addition to mmu-mir-190, several other miRNAs were also found to be downregulated in the corneal endothelium of old mice, including mmu-miR-31, mmu-miR-455, mmu-miR-744, mmu-miR-695, mmu-miR-181a, mmu-miR-181d, mmu-miR-182, and mmu-miR-194 [PMC3742134'>PMC3742134'>PMC3742134'>PMC3742134]. On the other hand, miRNAs such as mmu-miR-34c and mmu-miR124 were significantly upregulated in old mice compared to young mice [PMC3742134]. The downregulation of these miRNAs suggests a potential role in age-related changes in the corneal endothelium. To validate the results from the miRNA microarray analysis, qRT-PCR was performed for several miRNAs including mmu mir 190 using the same extracted total RNA as the microarray analysis [PMC3742134]. The qRT PCR results confirmed the downregulation of these miRNAs in old mice compared to young mice [PMC3742134]. Overall, these findings suggest that changes in expression levels of specific miRNAs including Mmu mir 190 may contribute to age-related alterations in corneal endothelial function [PMC3742134].
-U UA uuau cugug GAUAUGUUUGAUAUAU GGUug u ||||| |||||||||||||||| ||||| gacaU UUAUACGAACUAUAUA UCAac u CC -- cuaa
Accession | MIMAT0000220 |
Description | Mus musculus mmu-miR-190a-5p mature miRNA |
Sequence | 6 - UGAUAUGUUUGAUAUAUUAGGU - 27 |
Evidence |
experimental
cloned [1-2], Illumina [4] |
Database links | |
Predicted targets |
Accession | MIMAT0016998 |
Description | Mus musculus mmu-miR-190a-3p mature miRNA |
Sequence | 42 - ACUAUAUAUCAAGCAUAUUCCU - 63 |
Evidence |
experimental
454 [3], Illumina [4] |
Database links | |
Predicted targets |
|