miRBase entry: mmu-mir-191

Stem-loop mmu-mir-191


Accession
MI0000233
Symbol
MGI: Mir191
Description
Mus musculus mmu-mir-191 precursor miRNA mir-191
Gene
family?
RF00764; mir-191

Literature search
61 open access papers mention mmu-mir-191
(162 sentences)

Sequence

3770579 reads, 12102 reads per million, 122 experiments
agcgggCAACGGAAUCCCAAAAGCAGCUGuugucuccagagcauuccaGCUGCACUUGGAUUUCGUUCCCugcu
((((((.((((((((((.((..(((((((.(((.......)))...)))))))..)))))))))))).))))))

Structure
      C          C  AA       --u   cu 
agcggg AACGGAAUCC AA  GCAGCUG   ugu  c
|||||| |||||||||| ||  |||||||   |||  c
ucguCC UUGCUUUAGG UU  CGUCGac   acg  a
      C          -  CA       cuu   ag 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr9: 108568319-108568392 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-191
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-191-5p

Accession MIMAT0000221
Description Mus musculus mmu-miR-191-5p mature miRNA
Sequence 7 - CAACGGAAUCCCAAAAGCAGCUG - 29
Evidence experimental
cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-191-3p

Accession MIMAT0004542
Description Mus musculus mmu-miR-191-3p mature miRNA
Sequence 49 - GCUGCACUUGGAUUUCGUUCCC - 70
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009