miRBase entry: mmu-mir-195a

Stem-loop mmu-mir-195a


Accession
MI0000237
Symbol
MGI: Mir195a
Description
Mus musculus mmu-mir-195a precursor miRNA mir-15
Gene
family?
RF00455; mir-15

Literature search
100 open access papers mention mmu-mir-195a
(415 sentences)

Sequence

82573 reads, 728 reads per million, 106 experiments
acacccaacucuccuggcucUAGCAGCACAGAAAUAUUGGCauggggaagugagucugCCAAUAUUGGCUGUGCUGCUCCaggcagggugguga
.((((..((((((((((....((((((((((.((((((((((.((.........))))))))))))..))))))))))))))).))))))))).

Structure
a    ca     -     cucU          -A          u  gga 
 cacc  acucu ccugg    AGCAGCACAG  AAUAUUGGCa gg   a
 ||||  ||||| |||||    ||||||||||  |||||||||| ||   g
 gugg  uggga ggaCC    UCGUCGUGUC  UUAUAACCgu cu   u
a    --     c     ----          GG          -  gag 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr11: 70235042-70235135 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-195a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-195a-5p

Accession MIMAT0000225
Description Mus musculus mmu-miR-195a-5p mature miRNA
Sequence 21 - UAGCAGCACAGAAAUAUUGGC - 41
Evidence experimental
cloned [1-3], Illumina [4,6]
Database links
Predicted targets

Mature mmu-miR-195a-3p

Accession MIMAT0017000
Description Mus musculus mmu-miR-195a-3p mature miRNA
Sequence 59 - CCAAUAUUGGCUGUGCUGCUCC - 80
Evidence experimental
454 [5], Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 20668074
    Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
    "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
    "J Virol (2010) 84:10266-10275