miRBase entry: hsa-mir-197

Stem-loop hsa-mir-197


Accession
MI0000239
Symbol
HGNC: MIR197
Description
Homo sapiens hsa-mir-197 precursor miRNA mir-197
Gene
family?
RF00707; mir-197

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR197 is a microRNA that has been detected to change its expression in response to resistance training [PMC8505326]. It is one of several miRNAs that show immediate, 1-hour, 4-hour, and 24-hour changes in expression after a single bout of resistance training [PMC8505326]. MIR197 has been found to be inversely related to PD-L1 expression in acute myeloid leukemia, NSCLC, biliary epithelial cells, hepatocellular carcinoma, and colon cancer [PMC7529545]. It is considered a potential surrogate biomarker for PD-L1 expression in NSCLC [PMC7529545]. MIR197 levels have also been measured in sera using quantitative real-time polymerase chain reaction (PCR) [PMC7414326]. In the context of insulin resistance and glucose homeostasis, there appears to be an inverse correlation between glycemia and hepatic levels of MIR197 [PMC6197154]. MIR197 plays an important role in the maintenance of embryogenic callus in rice [PMC10049443]. In female breast cancer, up-regulation of MIR197 has not been reported so far [PMC2850898]. Changes in the levels of MIR197 have also been associated with metabolic syndrome [PMC8793096]. The DDB2 SNP rs1050244 may interfere with the targeted interaction between miR-133a and MIR197, resulting in upregulation of DDB2 mRNA expression and reduced susceptibility to HCC [PMC9712371]. Gap junction-transferred microRNAs including MIR197 have been shown to reduce cancer cell proliferation and induce dormancy that may lead to bone marrow metastasis relapse [PMC4699086].

Literature search
71 open access papers mention hsa-mir-197
(290 sentences)

Sequence

35297 reads, 379 reads per million, 117 experiments
ggcugugcCGGGUAGAGAGGGCAGUGGGAGGuaagagcucuucacccUUCACCACCUUCUCCACCCAGCauggcc
((((((((.((((.(((((((..(((((.((((((....))).))).)))))..))))))).)))).))))))))

Structure
        C    A       CA     A   -   a 
ggcugugc GGGU GAGAGGG  GUGGG GGu aag g
|||||||| |||| |||||||  ||||| ||| |||  
ccgguaCG CCCA CUCUUCC  CACUU cca uuc c
        A    C       AC     c   c   u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 109598893-109598967 [+]

Disease association
hsa-mir-197 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-197-3p

Accession MIMAT0000227
Description Homo sapiens hsa-miR-197-3p mature miRNA
Sequence 48 - UUCACCACCUUCUCCACCCAGC - 69
Evidence experimental
cloned [1-3]
Database links
Predicted targets

Mature hsa-miR-197-5p

Accession MIMAT0022691
Description Homo sapiens hsa-miR-197-5p mature miRNA
Sequence 9 - CGGGUAGAGAGGGCAGUGGGAGG - 31
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179