miRBase entry: hsa-mir-197

Stem-loop hsa-mir-197


Accession
MI0000239
Symbol
HGNC: MIR197
Description
Homo sapiens hsa-mir-197 precursor miRNA mir-197
Gene
family?
RF00707; mir-197

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR197 is a microRNA that has been identified as a key player in various biological processes and diseases. It is one of several miRNAs whose expression is altered immediately after a single bout of resistance training, suggesting a role in muscle adaptation or recovery [PMC8505326]. In the context of cancer, MIR197 has been associated with the regulation of PD-L1 expression and may serve as a potential surrogate biomarker for PD-L1 levels in certain cancers, including non-small cell lung cancer (NSCLC) [PMC7529545]. Moreover, MIR197 levels have been measured in sera using quantitative real-time PCR, indicating its potential as a biomarker for various physiological states or conditions [PMC7414326]. It also appears to have an inverse correlation with glycemia in the context of insulin resistance [PMC6197154] and plays an important role in maintaining embryogenic callus in rice [PMC10049443]. In breast cancer research, an up-regulation of MIR197 has been observed that had not been previously reported [PMC2850898]. Additionally, changes in MIR197 levels have been associated with metabolic syndrome [PMC8793096] and it may interact with single nucleotide polymorphisms (SNPs) to influence gene expression related to diseases such as hepatocellular carcinoma (HCC) [PMC9712371]. Furthermore, microRNAs including MIR197 can influence cancer cell proliferation and dormancy related to bone marrow metastasis [PMC4699086]. Lastly, it has been identified that MIR197 targets the tumor suppressor protein FUS1 which could have implications for its role in tumorigenesis [PMC3877139].

Literature search
71 open access papers mention hsa-mir-197
(290 sentences)

Sequence

35297 reads, 182 reads per million, 117 experiments
ggcugugcCGGGUAGAGAGGGCAGUGGGAGGuaagagcucuucacccUUCACCACCUUCUCCACCCAGCauggcc
((((((((.((((.(((((((..(((((.((((((....))).))).)))))..))))))).)))).))))))))

Structure
        C    A       CA     A   -   a 
ggcugugc GGGU GAGAGGG  GUGGG GGu aag g
|||||||| |||| |||||||  ||||| ||| |||  
ccgguaCG CCCA CUCUUCC  CACUU cca uuc c
        A    C       AC     c   c   u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 109598893-109598967 [+]

Disease association
hsa-mir-197 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-197-3p

Accession MIMAT0000227
Description Homo sapiens hsa-miR-197-3p mature miRNA
Sequence 48 - UUCACCACCUUCUCCACCCAGC - 69
Evidence experimental
cloned [1-3]
Database links
Predicted targets

Mature hsa-miR-197-5p

Accession MIMAT0022691
Description Homo sapiens hsa-miR-197-5p mature miRNA
Sequence 9 - CGGGUAGAGAGGGCAGUGGGAGG - 31
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179