WARNING: This summary was generated by AI. MIR30D is a microRNA that plays a significant role in the regulation of human adipocyte development [PMC5701175]. In a study involving 136 matched samples from CSCC patients, the copy number variations (CNVs) of MIR30D were analyzed in both cancer tissues and adjacent normal tissues (ANTs) [PMC5372318]. This analysis is crucial as it helps to understand the genetic alterations associated with cancer progression. Furthermore, MIR30D has been found to have increased expression in patients with chronic thromboembolic obstruction (CTO) when compared to healthy individuals, indicating its potential involvement in pathological conditions beyond adipocyte development [PMC4558025]. This elevated expression of MIR30D, along with miR126, suggests that it may have diagnostic or therapeutic implications for CTO and possibly other diseases.
guu U CCC guaaga gu GUAAACAUC GACUGGAAGcu c || ||||||||| ||||||||||| CG CGUUUGUAG CUGACUUUCga a cau U --A aucgac
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0000245 |
| Description | Homo sapiens hsa-miR-30d-5p mature miRNA |
| Sequence | 6 - UGUAAACAUCCCCGACUGGAAG - 27 |
| Evidence |
experimental
cloned [2-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004551 |
| Description | Homo sapiens hsa-miR-30d-3p mature miRNA |
| Sequence | 46 - CUUUCAGUCAGAUGUUUGCUGC - 67 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|