A study using mouse models for non-alcoholic fatty liver disease (NAFLD) found that liver cells exposed to excessive lipids released higher numbers of exosomes containing higher amounts of mmu-mir-122 and mmu-miR-192 [PMC7936154]. The motif corresponding to the seed of mmu-mir-122 was significantly overrepresented in the 3′UTRs of upregulated genes and underrepresented in the 3′UTRs of downregulated genes [PMC2820085]. Inhibition of mmu-mir-122 was found to be the primary cause for up-regulation of 372 genes, with 11% of these genes predicted to contain a perfect 8-mer binding site for mmu-mir-122 [PMC3125776]. In mice infected with S. japonicum, serum levels of mmu-miR-21, mmu-mir-122, and mmumiR-34a were significantly higher [PMC9650547]. Treatment with PB decreased hepatic levels of mmu-mir-122 in mice [PMC3399820]. Kupffer cells were found to express specific miRNAs including mmu-mir-122 [PMC8652219]. The expression levels of miR-122 were measured using real-time RT-qPCR and TaqMan assays [PMC3399820][PMC8652219][PMC8935237][PMC4569899[PMC8652219][PMC8935237][PMC4569899]. Transfection with an anti-sense oligonucleotide inhibitor increased mRNA expression levels for six genes including GYS1, SLC7A1, MINK1, ALDOA, CCNG1, and P4HA1 in a mouse hepatocyte-derived cell line [PMC5415838]. Down-regulation of mmu-mir-122 during high-fat diet (HFD)-induced obesity was observed in mice [PMC3319598]. Mmu-mir-122 is mainly expressed in the liver and constitutes 70% of all liver miRNAs [PMC3319598].
GG C - uc agcugU AGUGUGA AAUGGUGUUUG ug c |||||| ||||||| ||||||||||| || a ucgaUA UCACACU UUACCGCAAAc ac a AA A u ca
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0000246 |
Description | Mus musculus mmu-miR-122-5p mature miRNA |
Sequence | 6 - UGGAGUGUGACAAUGGUGUUUG - 27 |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links | |
Predicted targets |
Accession | MIMAT0017005 |
Description | Mus musculus mmu-miR-122-3p mature miRNA |
Sequence | 41 - AAACGCCAUUAUCACACUAAAU - 62 |
Evidence |
experimental
Illumina [4] |
Database links | |
Predicted targets |
|