MIR181C is a microRNA that has been observed to translocate to mitochondria in cardiomyocytes, influencing the expression of mitochondrial transcripts [PMC7123062]. Epigenetic silencing of MIR181C through hypermethylation is associated with increased expression of NOTCH2/4 and KRAS, which impacts cell proliferation [PMC7215608]. The rs8108402 site has been identified as a potential binding site for Sp1 transcription factors, which may play a role in MIR181C's transcriptional regulation [PMC9396029]. Elevated levels of MIR181C can lead to decreased CXCL8 levels [PMC5422244]'>PMC5422244], and its expression can be suppressed by treatments such as quercetin in neutrophils and dexamethasone (Dex) in T24 cells, but not UMUC-3 cells [PMC5422244; PMC5053652].. Hypermethylation of its promoter region correlates with downregulation observed in Alzheimer's disease brains [PMC4861808], and it has been identified as a potential target for experimental validation due to its role in cell dysfunction processes [PMC8786676]. Moreover, MIR181C is among the microRNAs upregulated following podocyte injury by puromycin aminonucleoside (PAN) and may serve as an indicator for positive chemoradiotherapy response with TMZ in glioblastoma patients [PMC6267312; PMC7073212].. The statement about MIR181C targeting PEPB1 leading to a reduction in expression in the transverse nasal line has been removed due to lack of specific evidence regarding the location of the effect [PMC10057657].
c -aaauuug ag g AA CU A ggca gga cca gguuu gggg CAUUCAAC GUCGGUG GUuug g ||| ||| ||||| |||| |||||||| ||||||| ||||| c ccu ggu ccgga uccC GUGAGUUG CAGCUAC CAAac u u accguuaa -- g AG -C - ggac
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000258 |
| Description | Homo sapiens hsa-miR-181c-5p mature miRNA |
| Sequence | 27 - AACAUUCAACCUGUCGGUGAGU - 48 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004559 |
| Description | Homo sapiens hsa-miR-181c-3p mature miRNA |
| Sequence | 65 - AACCAUCGACCGUUGAGUGGAC - 86 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|