MIR181C is a microRNA that translocates to mitochondria and affects the expression of mitochondrial transcripts in CMCs [PMC7123062]. It has been found to target phosphatidylethanolamine binding protein 1 (PEPB1) and is downregulated in the TvN in both the membrane and cytoplasmic fraction [PMC10057657]. When MIR181C is hypermethylated, it leads to increased expression of NOTCH2/4 and KRAS, which affects proliferation levels [PMC7215608]. The transcription factor binding analysis suggests that rs8108402 may be the binding site for Sp1 transcription factors, indicating its role in the transcriptional regulation of MIR181C [PMC9396029]. Elevated levels of MIR181C may contribute to the reduction of CXCL8 [PMC5422244]. Quercetin treatment has been shown to suppress MIR181C expression in neutrophils [PMC5422244]. Dex treatment decreases MIR181C expression in T24 cells but not UMUC-3 cells [PMC5053652]. Hypermethylation of MIR181C has been observed in AD brains, leading to downregulation of its corresponding transcript [PMC4861808]. MIR181C is among several miRNAs predicted to target H-2Kb and H-2Db [PMC7655649]. It has also been identified as a potential marker for a positive response to chemoradiotherapy with TMZ in glioblastoma patients [PMC7073212]. Additionally, miRNA mimics have been used for overexpression studies of miR181a and MIR181C with different time points posttransfection or postirradiation observed [PMC8786676].
c -aaauuug ag g AA CU A ggca gga cca gguuu gggg CAUUCAAC GUCGGUG GUuug g ||| ||| ||||| |||| |||||||| ||||||| ||||| c ccu ggu ccgga uccC GUGAGUUG CAGCUAC CAAac u u accguuaa -- g AG -C - ggac
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000258 |
Description | Homo sapiens hsa-miR-181c-5p mature miRNA |
Sequence | 27 - AACAUUCAACCUGUCGGUGAGU - 48 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004559 |
Description | Homo sapiens hsa-miR-181c-3p mature miRNA |
Sequence | 65 - AACCAUCGACCGUUGAGUGGAC - 86 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|