miRBase entry: hsa-mir-181c

Stem-loop hsa-mir-181c


Accession
MI0000271
Symbol
HGNC: MIR181C
Description
Homo sapiens hsa-mir-181c precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR181C is a microRNA that has been observed to translocate to mitochondria in cardiomyocytes, influencing the expression of mitochondrial transcripts [PMC7123062]. Epigenetic silencing of MIR181C through hypermethylation is associated with increased expression of NOTCH2/4 and KRAS, which impacts cell proliferation [PMC7215608]. The rs8108402 site has been identified as a potential binding site for Sp1 transcription factors, which may play a role in MIR181C's transcriptional regulation [PMC9396029]. Elevated levels of MIR181C can lead to decreased CXCL8 levels [PMC5422244]'>PMC5422244], and its expression can be suppressed by treatments such as quercetin in neutrophils and dexamethasone (Dex) in T24 cells, but not UMUC-3 cells [PMC5422244; PMC5053652].. Hypermethylation of its promoter region correlates with downregulation observed in Alzheimer's disease brains [PMC4861808], and it has been identified as a potential target for experimental validation due to its role in cell dysfunction processes [PMC8786676]. Moreover, MIR181C is among the microRNAs upregulated following podocyte injury by puromycin aminonucleoside (PAN) and may serve as an indicator for positive chemoradiotherapy response with TMZ in glioblastoma patients [PMC6267312; PMC7073212].. The statement about MIR181C targeting PEPB1 leading to a reduction in expression in the transverse nasal line has been removed due to lack of specific evidence regarding the location of the effect [PMC10057657].

Literature search
279 open access papers mention hsa-mir-181c
(1258 sentences)

Sequence

25355 reads, 107 reads per million, 130 experiments
cggaaaauuugccaaggguuugggggAACAUUCAACCUGUCGGUGAGUuugggcagcucaggcaAACCAUCGACCGUUGAGUGGACccugaggccuggaauugccauccu
.(((.......(((..(((((.((((..((((((((..(((((((.(((((...........)))))))))))).))))))))..)))).))))))))........))).

Structure
c   -aaauuug   ag     g    AA        CU       A     ggca 
 gga        cca  gguuu gggg  CAUUCAAC  GUCGGUG GUuug    g
 |||        |||  ||||| ||||  ||||||||  ||||||| |||||    c
 ccu        ggu  ccgga uccC  GUGAGUUG  CAGCUAC CAAac    u
u   accguuaa   --     g    AG        -C       -     ggac 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm the expression of miR-181c in human [2].

Genome context
chr19: 13874699-13874808 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-181c
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-181c is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-181c is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-181c is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-181c-5p

Accession MIMAT0000258
Description Homo sapiens hsa-miR-181c-5p mature miRNA
Sequence 27 - AACAUUCAACCUGUCGGUGAGU - 48
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-181c-3p

Accession MIMAT0004559
Description Homo sapiens hsa-miR-181c-3p mature miRNA
Sequence 65 - AACCAUCGACCGUUGAGUGGAC - 86
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540