WARNING: This summary was generated by AI. MIR187 is a microRNA implicated in the regulation of immune responses and has been observed to modulate the potassium channel KCNK10/TREK-2 in a rat epilepsy model [PMC7041117]. It acts as a negative modulator of lipopolysaccharide (LPS) responses, directly limiting TNF-α production and reducing IL-6 and IL-12p40 transcription by targeting the transcription factor IkB [PMC5900789]. MIR187 is also part of a miRNA network driven by IL-10, which promotes anti-inflammatory responses while suppressing pro-inflammatory miRNAs [PMC5900789]. Upon LPS stimulation, IL-10 enhances miR146b and sustains MIR187 expression in myeloid cells, indicating its role in inflammatory regulation [PMC5900789]. In reproductive pathology, MIR187 has been identified as significantly overexpressed in the villus of women with recurrent pregnancy loss (RPL) [PMC5572592], and its expression is associated with immune infiltration levels in different immune-infiltrating groups [PMC7163112]. These findings suggest that MIR187 may serve as a potential biomarker for immune-related conditions and could be a target for therapeutic intervention to modulate inflammatory responses.
g u caccaugacacag aga g A C - C - ug g cgggcu ugug ccuc GGCU CAACACAGGAC CG GG g c c | |||||| |||| |||| |||| ||||||||||| || || | | c gccugg acgc ggaG CCGA GUUGUGUUCUG GC cc c g u a - ------------- -ag G C U U c a uc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004561 |
| Description | Homo sapiens hsa-miR-187-5p mature miRNA |
| Sequence | 35 - GGCUACAACACAGGACCCGGGC - 56 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000262 |
| Description | Homo sapiens hsa-miR-187-3p mature miRNA |
| Sequence | 71 - UCGUGUCUUGUGUUGCAGCCGG - 92 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|