miRBase entry: hsa-mir-187

Stem-loop hsa-mir-187


Accession
MI0000274
Symbol
HGNC: MIR187
Description
Homo sapiens hsa-mir-187 precursor miRNA mir-187
Gene
family?
RF00674; mir-187

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR187 is a microRNA implicated in the regulation of immune responses and has been observed to modulate the potassium channel KCNK10/TREK-2 in a rat epilepsy model [PMC7041117]. It acts as a negative modulator of lipopolysaccharide (LPS) responses, directly limiting TNF-α production and reducing IL-6 and IL-12p40 transcription by targeting the transcription factor IkB [PMC5900789]. MIR187 is also part of a miRNA network driven by IL-10, which promotes anti-inflammatory responses while suppressing pro-inflammatory miRNAs [PMC5900789]. Upon LPS stimulation, IL-10 enhances miR146b and sustains MIR187 expression in myeloid cells, indicating its role in inflammatory regulation [PMC5900789]. In reproductive pathology, MIR187 has been identified as significantly overexpressed in the villus of women with recurrent pregnancy loss (RPL) [PMC5572592], and its expression is associated with immune infiltration levels in different immune-infiltrating groups [PMC7163112]. These findings suggest that MIR187 may serve as a potential biomarker for immune-related conditions and could be a target for therapeutic intervention to modulate inflammatory responses.

Literature search
157 open access papers mention hsa-mir-187
(591 sentences)

Sequence

13057 reads, 36.0 reads per million, 117 experiments
ggucgggcucaccaugacacagugugagaccucgGGCUACAACACAGGACCCGGGCgcugcucugaccccUCGUGUCUUGUGUUGCAGCCGGagggacgcagguccgca
.(.((((((.............((((...((((.((((.(((((((((((.((((.((......).).)).)).))))))))))).)))).))))..))))))))))).

Structure
g u      caccaugacacag    aga    g    A           C  -  C - ug 
 g cgggcu             ugug   ccuc GGCU CAACACAGGAC CG GG g c  c
 | ||||||             ||||   |||| |||| ||||||||||| || || | |   
 c gccugg             acgc   ggaG CCGA GUUGUGUUCUG GC cc c g  u
a -      -------------    -ag    G    C           U  U  c a uc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr18: 35904818-35904926 [-]

Disease association
hsa-mir-187 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-187-5p

Accession MIMAT0004561
Description Homo sapiens hsa-miR-187-5p mature miRNA
Sequence 35 - GGCUACAACACAGGACCCGGGC - 56
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-187-3p

Accession MIMAT0000262
Description Homo sapiens hsa-miR-187-3p mature miRNA
Sequence 71 - UCGUGUCUUGUGUUGCAGCCGG - 92
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540