MIR187 is a microRNA that is associated with the regulation of the potassium channel KCNK10/TREK-2 in a rat epilepsy model [PMC7041117]. It acts as a negative modulator of LPS responses by limiting TNF-α production and reducing IL-6 and IL-12p40 transcription [PMC5900789]. Through a complex network of miRNAs, MIR187 is upregulated by IL-10, which drives anti-inflammatory responses [PMC5900789]. In the context of recurrent pregnancy loss (RPL), MIR187 is significantly overexpressed in the villus of RPL women [PMC5572592]. It has also been identified as induced in RPL and suppressed in miR100, let7a, let7b, let7c, and miR21 [PMC4495342]. IL-10 has been shown to regulate the expression of MIR187 along with other miRNAs such as miR-155 and miR-146a/b [PMC5161420]. In immune infiltration studies, MIR187 expression levels were found to be highest in high-infiltrating groups compared to median-infiltrating and low-infiltrating groups [PMC7163112]. Additionally, MIR187 has been associated with immune responses along with other noncoding RNAs such as mir142, mir223, mir155, mir200a/b [PMC7163112]. Further research exploring the relationships between noncoding RNAs and immune responses is warranted [PMC7163112].
g u caccaugacacag aga g A C - C - ug g cgggcu ugug ccuc GGCU CAACACAGGAC CG GG g c c | |||||| |||| |||| |||| ||||||||||| || || | | c gccugg acgc ggaG CCGA GUUGUGUUCUG GC cc c g u a - ------------- -ag G C U U c a uc
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004561 |
Description | Homo sapiens hsa-miR-187-5p mature miRNA |
Sequence | 35 - GGCUACAACACAGGACCCGGGC - 56 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0000262 |
Description | Homo sapiens hsa-miR-187-3p mature miRNA |
Sequence | 71 - UCGUGUCUUGUGUUGCAGCCGG - 92 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|