miRBase entry: hsa-mir-203a

Stem-loop hsa-mir-203a


Accession
MI0000283
Symbol
HGNC: MIR203A
Description
Homo sapiens hsa-mir-203a precursor miRNA mir-203
Gene
family?
RF00696; mir-203

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR203A is a microRNA whose expression is crucial for maintaining the epithelial phenotype, and its low expression levels have been observed in the A2780 cell line, which were not significantly altered by estrogen treatments [PMC7766742, PMC7308478].. The hypermethylation of the MIR203A gene is proposed as a potential marker for predicting metastasis in ovarian cancer (OvCa), indicating its significance in cancer progression [PMC8835734]. The genomic location of MIR203A is identified on chromosome 14, which suggests its distinct regulatory region compared to other microRNAs in the MIR200 family [PMC7766742]. In advanced-stage IV OvCa patients, MIR203A is one of six microRNAs found to have altered expression levels [PMC9599289]. The study aimed to explore the dependency of estrogen receptor alpha (ERα) on the expression of miR200s and MIR203A, highlighting the potential hormonal regulation of these microRNAs [PMC7766742].

Literature search
297 open access papers mention hsa-mir-203a
(2724 sentences)

Sequence

49458 reads, 280 reads per million, 126 experiments
guguuggggacucgcgcgcuggguccAGUGGUUCUUAACAGUUCAACAGUUcuguagcgcaauuGUGAAAUGUUUAGGACCACUAGacccggcgggcgcggcgacagcga
.(((((..(.(.(((.(((((((((.(((((((((.((((.((((.((((((......).))))))))).)))).))))))))).))))))))).))).).)..))))).

Structure
g     gg a u   g         c         U    G    A     - ug 
 uguug  g c cgc cgcuggguc AGUGGUUCU AACA UUCA CAGUU c  u
 |||||  | | ||| ||||||||| ||||||||| |||| |||| ||||| |   
 gcgac  c g gcg gcggcccaG UCACCAGGA UUGU AAGU Guuaa g  a
a     ag g c   g         A         U    A    -     c cg 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2].

Genome context
chr14: 104117405-104117514 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-203a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-203a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-203a-3p

Accession MIMAT0000264
Description Homo sapiens hsa-miR-203a-3p mature miRNA
Sequence 65 - GUGAAAUGUUUAGGACCACUAG - 86
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-203a-5p

Accession MIMAT0031890
Description Homo sapiens hsa-miR-203a-5p mature miRNA
Sequence 27 - AGUGGUUCUUAACAGUUCAACAGUU - 51
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 17622355
    MicroRNAs: novel regulators involved in the pathogenesis of psoriasis?
    Sonkoly E, Wei T, Janson PC, Sääf A, Lundeberg L, Tengvall-Linder M, Norstedt G, Alenius H, Homey B, Scheynius A, Ståhle M, Pivarcsi A
    PLoS One (2007) 2:e610