MIR203A is a gene that is downregulated in certain cell lines, such as A2780, and its expression is not significantly increased in response to estrogen treatments [PMC7766742]. The hypermethylation of the MIR203A gene has been suggested as a marker for predicting the development of metastases in ovarian cancer [PMC8835734]. Previous studies have shown that MIR203A and the MIR200 family are downregulated in D492M cell lines and their expression is crucial for maintaining the epithelial phenotype [PMC7308478]. The MIR203A locus is located on chromosome 14, specifically at chr14:104097437–104137437 [PMC7766742'>PMC7766742]. In stage IV ovarian cancer patients, alterations in six miRNAs, including MIR203A, have been observed [PMC9599289]. Additionally, it has been demonstrated that MIR203A enhances cellular inflammatory responses and cell damage while reducing aggrecan and Col2A1 levels [PMC10002134]. The expression of miR200s and MIR203A was investigated to determine their dependence on ERα [PMC7766742]. References: - PMC7766742 - PMC8835734 - PMC7308478 - PMC9599289 - PMC10002134
g gg a u g c U G A - ug uguug g c cgc cgcuggguc AGUGGUUCU AACA UUCA CAGUU c u ||||| | | ||| ||||||||| ||||||||| |||| |||| ||||| | gcgac c g gcg gcggcccaG UCACCAGGA UUGU AAGU Guuaa g a a ag g c g A U A - c cg
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000264 |
Description | Homo sapiens hsa-miR-203a-3p mature miRNA |
Sequence | 65 - GUGAAAUGUUUAGGACCACUAG - 86 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0031890 |
Description | Homo sapiens hsa-miR-203a-5p mature miRNA |
Sequence | 27 - AGUGGUUCUUAACAGUUCAACAGUU - 51 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|