MIR204 is a microRNA that has been studied in various contexts [PMC5627761]. In a study using a PLGA delivery system-functionalized titanium, it was found that the presence of PLGA with MIR204 inhibitor did not affect cell survival and proliferation, as indicated by the similar growth curve observed among different cell populations over a 4-day monitoring period [PMC5627761]. Additionally, histone modifications (HDA3) and miRNAs (miR29, MIR204, miR146a, and miR24) have been implicated in the development of anterior segment diseases such as Primary Open Angle Glaucoma [PMC4588317]. Furthermore, a study investigated the correlation between liver fat accumulation due to IDH2 deficiency and MIR204 in a high-fat diet. The results showed a correlation between liver fat accumulation and MIR204 levels as determined by the Pearson correlation coefficient [PMC9492679]. These findings highlight the potential role of MIR204 in various biological processes and diseases.
ggcua cuuucuucau ucg U A U gagaau cagu gugac uggac UCCCUUUGUC UCCUA GCCU a |||| ||||| ||||| |||||||||| ||||| |||| u guca uacug acuUG AGGGAAACGG AGGGU CGga a ---cg ---------c uua C A - ggaagu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000265 |
Description | Homo sapiens hsa-miR-204-5p mature miRNA |
Sequence | 33 - UUCCCUUUGUCAUCCUAUGCCU - 54 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0022693 |
Description | Homo sapiens hsa-miR-204-3p mature miRNA |
Sequence | 72 - GCUGGGAAGGCAAAGGGACGU - 92 |
Evidence | not_experimental |
Database links | |
Predicted targets |
|