MIR211 is a cellular microRNA that has been implicated in the regulation of cell cycle progression in human osteosarcoma cells, where its overexpression has been observed to increase the percentage of cells in the G0/G1 phase and decrease the percentage in the S phase [PMC6617937]. This microRNA, along with others such as miR28, miR29b, miR138, and miR326, was selected for study due to its potential complementary target sequence within the HIV-1 genome [PMC3256098]. Additionally, MIR211 is known to be upregulated in various tumors including gliomas; however, its downregulation has been associated with increased sensitivity of glioma cells to temozolomide (TMZ), a chemotherapeutic agent [PMC7732422].
-----ucacc ccau uug U CA C agg c
ugg gugac ugggc UCCCUUUGU UCCUU GCCU gcu
||| ||||| ||||| ||||||||| ||||| |||| ||| u
acc cacug acuCG GGGGAAACG AGGGA CGgg cga
gaggcacgac -cuu uug U AC - --a g
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000268 |
| Description | Homo sapiens hsa-miR-211-5p mature miRNA |
| Sequence | 26 - UUCCCUUUGUCAUCCUUCGCCU - 47 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022694 |
| Description | Homo sapiens hsa-miR-211-3p mature miRNA |
| Sequence | 63 - GCAGGGACAGCAAAGGGGUGC - 83 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|