miRBase entry: hsa-mir-216a

Stem-loop hsa-mir-216a


Accession
MI0000292
Symbol
HGNC: MIR216A
Description
Homo sapiens hsa-mir-216a precursor miRNA mir-216
Gene
family?
RF00654; mir-216

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. Hsa-mir-216a is a microRNA that is notably abundant in exosomes derived from KLEC, suggesting a potential role in cellular communication [PMC5570218]. This microRNA, along with others such as hsa-mir-217 and hsa-mir-133b, has been identified as closely associated with target differentially expressed mRNAs (DEmRNAs), indicating its involvement in gene regulation [PMC5565391]. In the context of pancreatic adenocarcinoma, hsa-mir-216a is one of the miRNAs that exhibited significant expression differences between tumor and normal tissue samples, highlighting its potential as a biomarker for disease state [PMC9669652]. Furthermore, evidence suggests that hsa-mir-216a may contribute to the progression of colorectal adenocarcinoma (COAD), adding to its significance in cancer biology [PMC6111604]. The gene functions influenced by hsa-mir-216a could be subject to regulation by microRNA interference mechanisms, as predicted by computational models like TargetScan [PMC5062913]. However, in papillary renal cell carcinoma (PRCC), the expression levels of hsa-mir-216a were found to be negatively associated with patient overall survival rates, suggesting a complex role in this cancer type [PMC6522832]. Additionally, a positive correlation between the upregulation of hsa-mir-216a and improved overall survival has been observed in other studies [PMC7499949].

Literature search
169 open access papers mention hsa-mir-216a
(746 sentences)

Sequence

103112 reads, 531.0 reads per million, 91 experiments
gauggcugugaguuggcuUAAUCUCAGCUGGCAACUGUGAgauguucauacaaucccUCACAGUGGUCUCUGGGAUUAUgcuaaacagagcaauuuccuagcccucacga
((.(((((.((((((((.(((((((((..(((.((((((((.(((....)))....)))))))).))).))))))))).)))))..........))).))))).))....

Structure
----  u     u   ----------     u         CU   A        ---a   u 
    ga ggcug gag          uuggc UAAUCUCAG  GGC ACUGUGAg    ugu c
    || ||||| |||          ||||| |||||||||  ||| ||||||||    |||  
    cu ccgau cuu          aaucg AUUAGGGUC  CUG UGACACUc    aca a
agca  c     c   uaacgagaca     U         -U   G        ccua   u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr2: 55988950-55989059 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-216a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-216a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-216a-5p

Accession MIMAT0000273
Description Homo sapiens hsa-miR-216a-5p mature miRNA
Sequence 19 - UAAUCUCAGCUGGCAACUGUGA - 40
Evidence experimental
cloned [2], SOLiD [3]
Database links
Predicted targets

Mature hsa-miR-216a-3p

Accession MIMAT0022844
Description Homo sapiens hsa-miR-216a-3p mature miRNA
Sequence 58 - UCACAGUGGUCUCUGGGAUUAU - 79
Evidence experimental
SOLiD [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 22282338
    Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs
    "Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F"
    "RNA (2012) 18:472-484