miRBase entry: hsa-mir-223

Stem-loop hsa-mir-223


Accession
MI0000300
Symbol
HGNC: MIR223
Description
Homo sapiens hsa-mir-223 precursor miRNA mir-223
Gene
family?
RF00664; mir-223

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR223 is a microRNA that plays a significant role in the regulation of immune responses and cellular processes. In MIR223 deficient mice, an increase in granulocyte numbers with an abnormal phenotype and spontaneous inflammatory lung pathology has been observed, indicating MIR223's role in neutrophil regulation [PMC7871001]. This microRNA is notably enriched in microglia, suggesting its importance in the central nervous system [PMC6351131]. MIR223 can also influence endothelial cell function by regulating the expression of its mRNA targets, FBXW7 and EFNA1, when derived from thrombin-activated platelet-derived extracellular vesicles [PMC8468534]. In systemic lupus erythematosus (SLE) patients with active nephritis, a significant decrease in peripheral plasma MIR223 expression has been reported [PMC7871001], while its levels are depleted in tissues during hepatocellular carcinoma (HCC) but increased in serum, proposing its potential as a serum biomarker for HCC [PMC4581219]. Additionally, MIR223 has been implicated as a key regulator of apoptosis and cell growth through FBXW7 and is considered as a reference miRNA for studies due to its deregulation impact on cellular processes such as tumor metabolism and apoptosis [PMC9495386], [PMC4558025]. Furthermore, it targets key components involved in miRNA-mediated synaptic plasticity regulation pathways within the brain [PMC4783348].

Literature search
400 open access papers mention hsa-mir-223
(2690 sentences)

Sequence

106277 reads, 969 reads per million, 97 experiments
ccuggccuccugcagugccacgcucCGUGUAUUUGACAAGCUGAGUUggacacuccaugugguagagUGUCAGUUUGUCAAAUACCCCAagugcggcacaugcuuaccag
.((((......((((((((.((((..(.((((((((((((((......(((((((.........))))))))))))))))))))).)..)))).))))).)))...))))

Structure
c    ccuccu   -     a    cC U              GAGUUg       cau 
 cugg      gca gugcc cgcu  G GUAUUUGACAAGCU      gacacuc   g
 ||||      ||| ||||| ||||  | ||||||||||||||      |||||||   u
 gacc      cgu cacgg guga  C CAUAAACUGUUUGA      CUGUgag   g
-    ---auu   a     c    AC C              ------       aug 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chrX: 66018870-66018979 [+]

Disease association
hsa-mir-223 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-223-5p

Accession MIMAT0004570
Description Homo sapiens hsa-miR-223-5p mature miRNA
Sequence 26 - CGUGUAUUUGACAAGCUGAGUU - 47
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-223-3p

Accession MIMAT0000280
Description Homo sapiens hsa-miR-223-3p mature miRNA
Sequence 68 - UGUCAGUUUGUCAAAUACCCCA - 89
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540