MIR223 is a microRNA that plays a significant role in the regulation of immune responses and cellular processes. In MIR223 deficient mice, an increase in granulocyte numbers with an abnormal phenotype and spontaneous inflammatory lung pathology has been observed, indicating MIR223's role in neutrophil regulation [PMC7871001]. This microRNA is notably enriched in microglia, suggesting its importance in the central nervous system [PMC6351131]. MIR223 can also influence endothelial cell function by regulating the expression of its mRNA targets, FBXW7 and EFNA1, when derived from thrombin-activated platelet-derived extracellular vesicles [PMC8468534]. In systemic lupus erythematosus (SLE) patients with active nephritis, a significant decrease in peripheral plasma MIR223 expression has been reported [PMC7871001], while its levels are depleted in tissues during hepatocellular carcinoma (HCC) but increased in serum, proposing its potential as a serum biomarker for HCC [PMC4581219]. Additionally, MIR223 has been implicated as a key regulator of apoptosis and cell growth through FBXW7 and is considered as a reference miRNA for studies due to its deregulation impact on cellular processes such as tumor metabolism and apoptosis [PMC9495386], [PMC4558025]. Furthermore, it targets key components involved in miRNA-mediated synaptic plasticity regulation pathways within the brain [PMC4783348].
c ccuccu - a cC U GAGUUg cau cugg gca gugcc cgcu G GUAUUUGACAAGCU gacacuc g |||| ||| ||||| |||| | |||||||||||||| ||||||| u gacc cgu cacgg guga C CAUAAACUGUUUGA CUGUgag g - ---auu a c AC C ------ aug
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004570 |
| Description | Homo sapiens hsa-miR-223-5p mature miRNA |
| Sequence | 26 - CGUGUAUUUGACAAGCUGAGUU - 47 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000280 |
| Description | Homo sapiens hsa-miR-223-3p mature miRNA |
| Sequence | 68 - UGUCAGUUUGUCAAAUACCCCA - 89 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|