Accession
MI0000300
Symbol
HGNC:
MIR223
Description
Homo sapiens
hsa-mir-223 precursor miRNA
Gene family
MIPF0000067;
mir-223
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR223 is a microRNA that has been found to play a role in various biological processes. In MIR223 deficient mice, an increase in granulocyte numbers and abnormal phenotype has been observed, leading to the development of inflammatory lung pathology [PMC7871001]. Microarray analyses have shown that MIR223 is enriched in microglia [PMC6351131]. Another short RNA, MIR223 derived from thrombin activated PL-EVs, has been found to regulate the endothelial expression of FBXW7 and EFNA1 mRNA targets [PMC8468534]. While upregulation of MIR223 in peripheral plasma has been reported, its expression was significantly decreased in SLE patients with active nephritis [PMC7871001]. CircMTO1 was found to act as a sponge for both miR9 and MIR223 [PMC7093694]. In hepatocellular carcinoma (HCC), MIR223 levels are depleted in tissues but its concentration rises in serum, suggesting its potential as a serum biomarker for HCC [PMC4581219]. Mutated rs3750996 was reported to affect the binding affinity of MIR223 but further investigations are needed to determine its influence on STIM1 gene expression [PMC7767290]. Deregulated miRNAs such as miR199-214, miR371-373, and MIR223 have been implicated in various cellular processes including tumor metabolism, p53 pathway regulation, cell cycle regulation, Wnt/β-catenin signaling, apoptosis and cell growth through FBXW7 [PMC9495386]. In the miRNA-mediated synaptic plasticity regulating pathway, MIR501 targets GluR1 while both MIR223 and miR134 target GluR2 and NR2B respectively [PMC4783348].
Literature search
400 open access papers mention hsa-mir-223
(2690 sentences)
(2690 sentences)
Sequence
106277
reads,
1820
reads per million, 97 experiments
ccuggccuccugcagugccacgcucCGUGUAUUUGACAAGCUGAGUUggacacuccaugugguagagUGUCAGUUUGUCAAAUACCCCAagugcggcacaugcuuaccag
.((((......((((((((.((((..(.((((((((((((((......(((((((.........))))))))))))))))))))).)..)))).))))).)))...))))
.((((......((((((((.((((..(.((((((((((((((......(((((((.........))))))))))))))))))))).)..)))).))))).)))...))))
Structure
c ccuccu - a cC U GAGUUg cau cugg gca gugcc cgcu G GUAUUUGACAAGCU gacacuc g |||| ||| ||||| |||| | |||||||||||||| ||||||| u gacc cgu cacgg guga C CAUAAACUGUUUGA CUGUgag g - ---auu a c AC C ------ aug
Annotation confidence
High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].
Genome context
chrX: 66018870-66018979 [+]
Disease association
hsa-mir-223 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-223-5p
| Accession | MIMAT0004570 |
| Description | Homo sapiens hsa-miR-223-5p mature miRNA |
| Sequence | 26 - CGUGUAUUUGACAAGCUGAGUU - 47 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
Mature hsa-miR-223-3p
| Accession | MIMAT0000280 |
| Description | Homo sapiens hsa-miR-223-3p mature miRNA |
| Sequence | 68 - UGUCAGUUUGUCAAAUACCCCA - 89 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
References
|
