MIR224 is a microRNA that plays a significant role in various biological processes and has been linked to diseases such as cancer and autoimmune disorders [PMC5351619]. Its expression increases when Cx43 is reduced in siAQP4 treated animals, suggesting a regulatory relationship [PMC5843607]. Estradiol is a crucial regulator of MIR224, which has implications for esophageal adenocarcinoma and esophageal squamous cell carcinoma [PMC6609598]. MIR224 is also considered a potential biomarker for esophageal adenocarcinoma, as indicated by its association with the disease [PMC6609598]. In pancreatic adenocarcinoma, MIR224 is involved in disease progression, and in ovarian cancer, it contributes to chemoresistance by affecting the PRKCD pathway [PMC6005310; PMC8071157].. In colorectal cancer, MIR224 targets genes such as glycine methyltransferases and is involved in the epithelial-mesenchymal transition by interacting with the Smad7/TGFβ pathway [PMC9775527; PMC5240405].. It has been identified as an overexpressed prognostic marker in colorectal cancer and WNT medulloblastomas [PMC5935085; PMC4333163].. MIR224's interaction with Smad4 and HOXD10 promotes cell migration in hepatocellular carcinoma and colorectal cancer, and it also regulates natural killer cell function by modulating NCR1 transcript levels [PMC5226496; PMC9166526].. Dysregulation of MIR224 is linked to the loss of cell cycle control in hepatocellular carcinoma and to changes in angiogenesis following a stroke [PMC6271763; PMC6732937]..
CA U U A u u
gggcuuU AGUCACUAG GGU CCGUUU G agaugau g
||||||| ||||||||| ||| |||||| | ||||||| u
cccgaaA UCAGUGAUC CCG GGUAAA c uuuguua g
CA - U A - c
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000281 |
| Description | Homo sapiens hsa-miR-224-5p mature miRNA |
| Sequence | 7 - UCAAGUCACUAGUGGUUCCGUUUAG - 31 |
| Evidence |
experimental
cloned [1-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0009198 |
| Description | Homo sapiens hsa-miR-224-3p mature miRNA |
| Sequence | 53 - AAAAUGGUGCCCUAGUGACUACA - 75 |
| Evidence |
experimental
qRT-PCR [5], 454 [6] |
| Database links |
|
| Predicted targets |
|
|