miRBase entry: cel-mir-228

Stem-loop cel-mir-228


Accession
MI0000303
Description
Caenorhabditis elegans cel-mir-228 precursor miRNA mir-228
Gene
family?
RF00843; mir-228

Literature search
10 open access papers mention cel-mir-228
(28 sentences)

Sequence

3855574 reads, 18559 reads per million, 16 experiments
ccuuaucccguucgcAAUGGCACUGCAUGAAUUCACGGcuaugcauaacgacagaccGCGGAUCAUACGGUACCAUAGCggacggugaugagguuaau
(((((((((((((((.((((.((((.((((.(((.(((((.(........).)).))).))))))).)))).)))).)))))))).))))))).....

Structure
-----       -        A    C    C    A   A   -  a gca 
     ccuuauc ccguucgc AUGG ACUG AUGA UUC CGG cu u   u
     ||||||| |||||||| |||| |||| |||| ||| ||| || |    
     ggaguag ggcaggCG UACC UGGC UACU AGG Gcc ga a   a
uaauu       u        A    A    A    -   C   a  c gca 


Annotation confidence High
Do you think this miRNA is real?
Comments
This precursor sequence was predicted by comparative computational approaches [1,2]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed, and the 5' and 3' ends were confirmed later [4].

Genome context
chrIV: 5562025-5562122 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from cel-mir-228
Name Accession Chromosome Start End Strand Confidence




Database links

Mature cel-miR-228-5p

Accession MIMAT0000283
Description Caenorhabditis elegans cel-miR-228-5p mature miRNA
Sequence 16 - AAUGGCACUGCAUGAAUUCACGG - 38
Evidence experimental
cloned [1], Northern [1,3], PCR [3], 454 [4], Illumina [5,7], CLIPseq [6]
Database links
Predicted targets

Mature cel-miR-228-3p

Accession MIMAT0020327
Description Caenorhabditis elegans cel-miR-228-3p mature miRNA
Sequence 58 - GCGGAUCAUACGGUACCAUAGC - 79
Evidence experimental
Illumina [7]
Database links

References

  1. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  2. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  3. PubMed ID: 12769849
    Computational and experimental identification of C. elegans microRNAs
    "Grad Y, Aach J, Hayes GD, Reinhart BJ, Church GM, Ruvkun G, Kim J"
    "Mol Cell (2003) 11:1253-1263

  4. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  5. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  6. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  7. PubMed ID: 21307183
    Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
    "Warf MB, Johnson WE, Bass BL"
    "RNA (2011) 17:563-577