miRBase entry: cel-mir-229

Stem-loop cel-mir-229


Accession
MI0000304
Description
Caenorhabditis elegans cel-mir-229 precursor miRNA

Literature search
3 open access papers mention cel-mir-229
(11 sentences)

Sequence

104332 reads, 2227 reads per million, 16 experiments
cgccggcAAUGACACUGGUUAUCUUUUCCAUCGuggaaugccccccauugauuuuuuccccuuuucggggggaaaaaauuggaaacgAGAAAGGUAUCGGGUGUCAUAGccggcg
(((((((.((((((((.(.((((((((...((((((......))(((...(((((((((((((...))))))))))))))))..)))))))))))).).)))))))).)))))))

Structure
       A        G U        CCA    ggaaugcccc   uug             u 
cgccggc AUGACACU G UAUCUUUU   UCGu          cca   auuuuuuccccuu  
||||||| |||||||| | ||||||||   ||||          |||   ||||||||||||| u
gcggccG UACUGUGG C AUGGAAAG   Agca          ggu   uaaaaaagggggg  
       A        G U        ---    --------aa   ---             c 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [3].

Genome context
chrIII: 2172452-2172566 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from cel-mir-229
Name Accession Chromosome Start End Strand Confidence




Database links

Mature cel-miR-229-5p

Accession MIMAT0000284
Description Caenorhabditis elegans cel-miR-229-5p mature miRNA
Sequence 8 - AAUGACACUGGUUAUCUUUUCCAUCG - 33
Evidence experimental
cloned [1-2], Northern [1], 454 [3], Illumina [4], CLIPseq [5]
Database links
Predicted targets

Mature cel-miR-229-3p

Accession MIMAT0015112
Description Caenorhabditis elegans cel-miR-229-3p mature miRNA
Sequence 88 - AGAAAGGUAUCGGGUGUCAUAG - 109
Evidence experimental
CLIPseq [5]
Database links

References

  1. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  2. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  3. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  4. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  5. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179