miRBase entry: cel-mir-231

Stem-loop cel-mir-231


Accession
MI0000306
Description
Caenorhabditis elegans cel-mir-231 precursor miRNA mir-231
Gene
family?
RF00852; mir-231

Literature search
3 open access papers mention cel-mir-231
(74 sentences)

Sequence

12777 reads, 257 reads per million, 16 experiments
uagcaccacagguuguuCUGACUGUUUCAAAAGCUUGUAguaucuuaauaaauaaacauaUAAGCUCGUGAUCAACAGGCAGAAcaacucgguuuugug
....(((...((((((((((.((((((((..((((((((((..............)).))))))))..)))..))))).)))))))))).)))......

Structure
--uagc   aca          A     --   AA        -  aucuua 
      acc   gguuguuCUG CUGUU  UCA  AGCUUGUA gu      a
      |||   |||||||||| |||||  |||  |||||||| ||       
      ugg   ucaacAAGAC GACAA  AGU  UCGAAUau ca      u
guguuu   --c          G     CU   GC        a  aauaaa 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chrIII: 7545057-7545155 [-]

Database links

Mature cel-miR-231-3p

Accession MIMAT0000286
Description Caenorhabditis elegans cel-miR-231-3p mature miRNA
Sequence 61 - UAAGCUCGUGAUCAACAGGCAGAA - 84
Evidence experimental
cloned [1-2], Northern [1], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

Mature cel-miR-231-5p

Accession MIMAT0020328
Description Caenorhabditis elegans cel-miR-231-5p mature miRNA
Sequence 18 - CUGACUGUUUCAAAAGCUUGUA - 39
Evidence experimental
Illumina [6]
Database links

References

  1. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  2. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  3. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  4. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  5. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  6. PubMed ID: 21307183
    Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
    "Warf MB, Johnson WE, Bass BL"
    "RNA (2011) 17:563-577