miRBase entry: cel-mir-235

Stem-loop cel-mir-235


Accession
MI0000310
Description
Caenorhabditis elegans cel-mir-235 precursor miRNA
Gene family
MIPF0000367; mir-235

Literature search
2 open access papers mention cel-mir-235
(5 sentences)

Sequence

147028 reads, 846 reads per million, 16 experiments
uccgaagauaucaggaucAGGCCUUGGCUGAUUGCAAAAUUguucaccgugaaaauuaaaUAUUGCACUCUCCCCGGCCUGAucugagaguaaggcg
.((.......((((.((((((((..((..((.(((((((((.((((...)))))))).....))))).))..)).))))))))))))......))..

Structure
-u  gaagaua    g        UU  CU  U     -----    g    c 
  cc       ucag aucAGGCC  GG  GA UGCAA     AAUU uuca  
  ||       |||| ||||||||  ||  || |||||     |||| |||| c
  gg       aguc uAGUCCGG  CC  CU ACGUU     uuaa aagu  
gc  -aaugag    -        -C  CU  C     AUaaa    -    g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrI: 6162291-6162387 [-]

Database links

Mature cel-miR-235-3p

Accession MIMAT0000290
Description Caenorhabditis elegans cel-miR-235-3p mature miRNA
Sequence 61 - UAUUGCACUCUCCCCGGCCUGA - 82
Evidence experimental
cloned [1], Northern [1], 454 [3], Illumina [4,6], CLIPseq [5]
Database links
Predicted targets

Mature cel-miR-235-5p

Accession MIMAT0020331
Description Caenorhabditis elegans cel-miR-235-5p mature miRNA
Sequence 19 - AGGCCUUGGCUGAUUGCAAAAUU - 41
Evidence experimental
Illumina [6]
Database links

References

  1. PubMed ID: 12672692
    The microRNAs of Caenorhabditis elegans
    "Lim LP, Lau NC, Weinstein EG, Abdelhakim A, Yekta S, Rhoades MW, Burge CB, Bartel DP"
    "Genes Dev (2003) 17:991-1008

  2. PubMed ID: 12747828
    MicroRNAs and other tiny endogenous RNAs in C. elegans
    "Ambros V, Lee RC, Lavanway A, Williams PT, Jewell D"
    "Curr Biol (2003) 13:807-818

  3. PubMed ID: 17174894
    Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans
    "Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP"
    "Cell (2006) 127:1193-1207

  4. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  5. PubMed ID: 20062054
    Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans
    "Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW"
    "Nat Struct Mol Biol (2010) 17:173-179

  6. PubMed ID: 21307183
    Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
    "Warf MB, Johnson WE, Bass BL"
    "RNA (2011) 17:563-577