Cel-mir-239b is a microRNA (miRNA) that is used as a negative control in various experiments. It has minimal sequence identity with miRNAs in human, mouse, and rat [PMC2699527]. In different studies, cel-mir-239b has been used as a control miRNA in experiments involving the inhibition of miRNAs function [PMC7253519]. It has been co-transfected with different vectors and synthetic miRNAs to assess the effects on gene expression [PMC7253519]. Cel-mir-239b has also been used as a negative control in studies involving the transfection of microRNA mimics and inhibitors [PMC7708977] [PMC9617134] [PMC4260481] [PMC4546478] [PMC3743786]. Additionally, cel-mir-239b has been employed as a negative control in experiments using siRNAs to minimize off-target effects and equalize the total amount of small RNA [PMC8019740] [PMC3572043]. It has also been used as a negative control in studies investigating microRNA expression and gene regulation using mimics or inhibitors of specific miRNAs [PMC6502783] [PMC4308918] [PMC5460990] [ [ [ [ [ [ . In summary, cel-mir-239b is commonly used as a negative control in various experimental settings to assess the specific effects of other miRNAs or RNAi molecules.
-------- aga a UA A - a ua gcgac ugc auuUUUGUAC CACAAAAGU CUG guc uu a ||||| ||| |||||||||| ||||||||| ||| ||| || cguug acg uAAAAACGUG GUGUUUUCA Gac cgg ag g ucuauuuu --a g UG C u - uu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0000295 |
Description | Caenorhabditis elegans cel-miR-239b-5p mature miRNA |
Sequence | 16 - UUUGUACUACACAAAAGUACUG - 37 |
Evidence |
experimental
cloned [3], Illumina [4], CLIPseq [5] |
Database links | |
Predicted targets |
Accession | MIMAT0015115 |
Description | Caenorhabditis elegans cel-miR-239b-3p mature miRNA |
Sequence | 58 - GCACUUUUGUGGUGUGCAAAAA - 79 |
Evidence |
experimental
CLIPseq [5] |
Database links |
|