WARNING: This summary was generated by AI. Cel-mir-239b is a microRNA from Caenorhabditis elegans used as a negative control in various studies due to its minimal sequence identity with miRNAs in human, mouse, and rat [PMC2699527]. It is employed to differentiate the specific effects of other miRNAs being investigated, as it does not target human genes [PMC7708977]. In experiments involving the FXN gene, cel-mir-239b did not cause a decrease in FXN mRNA and protein levels, unlike specific human miRNAs such as hsa-miR-224-5p [PMC7253519]. This control microRNA is used across various cell types and conditions to ensure that observed effects can be attributed to the experimental miRNA rather than nonspecific effects of transfection or experimental manipulation [PMC7708977][PMC9617134][PMC4260481][PMC4546478[PMC9617134][PMC4260481][PMC4546478]. Cel-mir-239b is also used in gene regulation studies as a negative control to validate the specificity of miRNA-mimic or inhibitor effects on target gene expression [PMC6027187]. Additionally, it serves as a control in vivo when assessing the biological impact of other miRNAs on physiological processes or disease models [PMC5460990]. Overall, cel-mir-239b functions as an essential tool for validating experimental results by providing a baseline against which the activity of other microRNAs can be measured [PMC3743786][PMC8019740][PMC3572043][PMC6502783][PMC4308918][PMC5460990][PMC8019740][PMC3572043][PMC6502783][PMC4308918][PMC5460990][ PMC3422229] [ PMC4104030] .
-------- aga a UA A - a ua
gcgac ugc auuUUUGUAC CACAAAAGU CUG guc uu a
||||| ||| |||||||||| ||||||||| ||| ||| ||
cguug acg uAAAAACGUG GUGUUUUCA Gac cgg ag g
ucuauuuu --a g UG C u - uu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0000295 |
| Description | Caenorhabditis elegans cel-miR-239b-5p mature miRNA |
| Sequence | 16 - UUUGUACUACACAAAAGUACUG - 37 |
| Evidence |
experimental
cloned [3], Illumina [4], CLIPseq [5] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0015115 |
| Description | Caenorhabditis elegans cel-miR-239b-3p mature miRNA |
| Sequence | 58 - GCACUUUUGUGGUGUGCAAAAA - 79 |
| Evidence |
experimental
CLIPseq [5] |
| Database links |
|
|