miRBase entry: dme-mir-285

Stem-loop dme-mir-285


Accession
MI0000377
Description
Drosophila melanogaster dme-mir-285 precursor miRNA

Literature search
8 open access papers mention dme-mir-285
(13 sentences)

Sequence

63024 reads, 1771 reads per million, 46 experiments
ucgaaucgaagaACUGAGAUCGAUUGGUGCAUAGAuaucaggagaacccacucaauuuaacucUAGCACCAUUCGAAAUCAGUGCuuuugauaagaaac
((..(((((((.(((((..((((.((((((.((((......(((......)))........)))))))))).))))..)))))..)))))))..))...

Structure
---  ga       -a     GA    U      A    --uaucag   aa 
   uc  aucgaag  ACUGA  UCGA UGGUGC UAGA        gag  c
   ||  |||||||  |||||  |||| |||||| ||||        |||   
   ag  uaguuuu  UGACU  AGCU ACCACG AUcu        cuc  c
caa  aa       CG     AA    U      -    caauuuaa   ac 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
miR-285 was reported independently in references [1] and [2]. Computational prediction followed by northern blotting confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [2] confirmed the ends of the excised miRNA by cloning.

Genome context
chr3L: 11946093-11946191 [-]

Database links

Mature dme-miR-285-3p

Accession MIMAT0000356
Description Drosophila melanogaster dme-miR-285-3p mature miRNA
Sequence 64 - UAGCACCAUUCGAAAUCAGUGC - 85
Evidence experimental
cloned [2], 454 [3], Illumina [4]
Database links
Predicted targets

Mature dme-miR-285-5p

Accession MIMAT0020817
Description Drosophila melanogaster dme-miR-285-5p mature miRNA
Sequence 13 - ACUGAGAUCGAUUGGUGCAUAGA - 35
Evidence not_experimental
Database links

References

  1. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  2. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  3. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879

  4. PubMed ID: 12844358
    Computational identification of Drosophila microRNA genes
    "Lai EC, Tomancak P, Williams RW, Rubin GM"
    "Genome Biol (2003) 4:R42