Accession
MI0000378
Description
Drosophila melanogaster
dme-mir-100 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Dme-mir-100 is a derived mature microRNA that is assigned the name dme-mir-100 for the guide strand and dme-mir-100* for the passenger strand [PMC4451068]. The prefix "dme" in dme-mir-100 designates the organism, Drosophila melanogaster, and is followed by sequentially assigned numbers [PMC4718083]. Dme-mir-100, along with dme-miR-92a and dme-miR-124, was selected based on data generated in a laboratory and their orthology with human miRNAs [PMC5090246]. Drosophila miRNAs, including dme-mir-100, show extensive overall similarity with human miRNAs with 5' mismatches [PMC2486268]. The expression profiles of dme-mir-100 have low correlation coefficients with profiles of its corresponding miRNA* [PMC3150300]. A weak correlation between dme-mir-100 and its passenger strand (dme-mir-100*) suggests possible regulation during its maturation [PMC3150300]. Notably, tissue-specific A-to-I editing of dme-mir-100 has been observed in male heads and a cell line [PMC3150300]. The expression profiles of dme-miR-305, along with other miRNAs including dme-miR-283 and dmiR992, are weakly correlated to at least one miRNA from their clusters [PMC3150300]. Independent regulation of both Drosophila let7 (dmiR let7) and mir 100 has been observed during post-transcriptional regulation [PMC3150300]. Several other miRNAs have also been reported to be involved in metamorphosis development in insects including DmiR125, DmiR34a, and DmiR14 [PMC5689003].
Literature search
18 open access papers mention dme-mir-100
(82 sentences)
(82 sentences)
Sequence
10859
reads,
245
reads per million, 46 experiments
ccauuaacagaAACCCGUAAAUCCGAACUUGUGcuguuuuauaucuguuaCAAGACCGGCAUUAUGGGAGUCugucaaugcaaacaacugguuuuuggca
.((((.(((((..(((((((..(((..(((((((.(........).).))))))..)))..)))))))..))))).))))....................
.((((.(((((..(((((((..(((..(((((((.(........).).))))))..)))..)))))))..))))).))))....................
Structure
-------------------c a AA AU AA - u uuu
cauu acaga CCCGUAA CCG CUUGUG c g u
|||| ||||| ||||||| ||| |||||| | |
guaa uguCU GGGUAUU GGC GAACau g c a
acgguuuuuggucaacaaac c GA AC CA u u uau
Annotation confidence
High
Do you think this miRNA is real?
Comments
miR-100 was reported independently by three groups using computational prediction [2], Northern blot analysis [1] and cloning [3]. References [1] and [2] confirmed that the strand containing the predicted miR is predominantly expressed [1]. Reference [3] confirmed the ends of the excised miRNA by cloning.
Genome context
chr2L: 18471434-18471533 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from dme-mir-100
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Database links
Mature dme-miR-100-5p
| Accession | MIMAT0000357 |
| Description | Drosophila melanogaster dme-miR-100-5p mature miRNA |
| Sequence | 12 - AACCCGUAAAUCCGAACUUGUG - 33 |
| Evidence |
experimental
Northern [1,3], 454 [4-5], Illumina [5] |
| Database links |
|
| Predicted targets |
|
Mature dme-miR-100-3p
| Accession | MIMAT0020818 |
| Description | Drosophila melanogaster dme-miR-100-3p mature miRNA |
| Sequence | 51 - CAAGACCGGCAUUAUGGGAGUC - 72 |
| Evidence | not_experimental |
| Database links |
|
References
|
