miRBase entry: dme-bantam

Stem-loop dme-bantam


Accession
MI0000387
Description
Drosophila melanogaster dme-bantam precursor miRNA bantam
Gene
family?
RF00727; bantam

Literature search
164 open access papers mention dme-bantam
(952 sentences)

Sequence

9330828 reads, 48601.0 reads per million, 51 experiments
auuugacuacgaaaCCGGUUUUCGAUUUGGUUUGACUguuuuucauacaagUGAGAUCAUUUUGAAAGCUGAUUuugucaa
........((((((.((((((((((..((((((.(((((.......)).))).))))))..)))))))))).))))))...

Structure
auuugacu      C          UU      G   -  uu 
        acgaaa CGGUUUUCGA  UGGUUU ACU gu  u
        |||||| ||||||||||  |||||| ||| ||  u
        uguuUU GUCGAAAGUU  ACUAGA Uga ca  c
-----aac      A          UU      G   a  ua 


Annotation confidence High
Do you think this miRNA is real?
Comments
bantam microRNA was predicted independently by two groups using computational approaches [1,2]. Northern blotting confirmed that the strand containing the predicted miR is predominantly expressed. Subsequent cloning studies have independently identified the same miRNA and confirmed the 5' end [3]. A length distribution of 20-23 nt was reported with a 23 nt sequence the most commonly expressed. bantam is reported to promote tissue growth [1]. bantam expression is temporally and spatially regulated in response to patterning cues. bantam microRNA simultaneously stimulates cell proliferation and prevents apoptosis and is predicted to target the pro-apoptotic gene hid [1].

Genome context
chr3L: 642208-642288 [+]

Database links

Mature dme-bantam-5p

Accession MIMAT0020823
Description Drosophila melanogaster dme-bantam-5p mature miRNA
Sequence 15 - CCGGUUUUCGAUUUGGUUUGACU - 37
Evidence not_experimental
Database links

Mature dme-bantam-3p

Accession MIMAT0000365
Description Drosophila melanogaster dme-bantam-3p mature miRNA
Sequence 52 - UGAGAUCAUUUUGAAAGCUGAUU - 74
Evidence experimental
Northern [1], cloned [3], 454 [5-6], Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  2. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  3. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879

  4. PubMed ID: 12844358
    Computational identification of Drosophila microRNA genes
    "Lai EC, Tomancak P, Williams RW, Rubin GM"
    "Genome Biol (2003) 4:R42

  5. PubMed ID: 12679032
    bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila
    "Brennecke J, Hipfner DR, Stark A, Russell RB, Cohen SM"
    "Cell (2003) 113:25-36

  6. PubMed ID: 12946623
    Big things from a little RNA
    "Moberg KH, Hariharan IK"
    "Trends Cell Biol (2003) 13:455-457