Stem-loop mmu-mir-301a

Accession

MI0000401

Description

Mus musculus mmu-mir-301a precursor miRNA

Literature search

51 open access papers mention mmu-mir-301a
(652 sentences)

Sequence

139890 reads, 1108 reads per million, 107 experiments

ccugcuaacggcuGCUCUGACUUUAUUGCACUACUguacuuuacagcgagCAGUGCAAUAGUAUUGUCAAAGCauccgcgagcagg
((((((..(((.((((.((((.((((((((((.((((........)).)).))))))))))....)))).)))).)))..))))))

Structure

      aa   c    C    ---U          A  -  acu 
ccugcu  cgg uGCU UGAC    UUAUUGCACU CU gu   u
||||||  ||| |||| ||||    |||||||||| || ||    
ggacga  gcc aCGA ACUG    GAUAACGUGA ga cg   u
      gc   u    A    UUAU          C  g  aca 

Annotation confidence High

Genome context

chr11: 87113004-87113089 [+]

Mature mmu-miR-301a-5p

• Accession: MIMAT0017008
• Description: Mus musculus mmu-miR-301a-5p mature miRNA
• Sequence: 14 - GCUCUGACUUUAUUGCACUACU - 35
• Evidence: experimental ; 454 [5], Illumina [6]

Mature mmu-miR-301a-3p

• Accession: MIMAT0000379
• Description: Mus musculus mmu-miR-301a-3p mature miRNA
• Sequence: 51 - CAGUGCAAUAGUAUUGUCAAAGC - 73
• Evidence: experimental ; cloned [1-3], Northern [1], Illumina [4,6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 12919684
   Embryonic stem cell-specific MicroRNAs
   "Houbaviy HB, Murray MF, Sharp PA"
   "Dev Cell (2003) 5:351-358


3. PubMed ID: 15538371
   A pancreatic islet-specific microRNA regulates insulin secretion
   "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
   "Nature (2004) 432:226-230


4. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


5. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


6. PubMed ID: 20668074
   Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68
   "Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H"
   "J Virol (2010) 84:10266-10275