miRBase entry: dme-let-7

Stem-loop dme-let-7


Accession
MI0000416
Description
Drosophila melanogaster dme-let-7 precursor miRNA

Literature search
78 open access papers mention dme-let-7
(811 sentences)

Sequence

793435 reads, 7294 reads per million, 49 experiments
ucuggcaaauUGAGGUAGUAGGUUGUAUAGUaguaauuacacaucauaCUAUACAAUGUGCUAGCUUUCUuugcuuga
((.((((((..(((.(((((.(((((((((((..............))))))))))).))))).)))..)))))).))

Structure
  u      uU   G     G           guaauu 
uc ggcaaa  GAG UAGUA GUUGUAUAGUa      a
|| ||||||  ||| ||||| |||||||||||       
ag ucguuU  UUC AUCGU UAACAUAUCau      c
  u      CU   G     G           acuaca 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr2L: 18472034-18472111 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from dme-let-7
Name Accession Chromosome Start End Strand Confidence




Database links

Mature dme-let-7-5p

Accession MIMAT0000396
Description Drosophila melanogaster dme-let-7-5p mature miRNA
Sequence 11 - UGAGGUAGUAGGUUGUAUAGU - 31
Evidence experimental
cloned [1], Northern [1-3], 454 [4-5], Illumina [5]
Database links
Predicted targets

Mature dme-let-7-3p

Accession MIMAT0020830
Description Drosophila melanogaster dme-let-7-3p mature miRNA
Sequence 49 - CUAUACAAUGUGCUAGCUUUCU - 70
Evidence not_experimental
Database links

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 12812784
    Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity
    "Sempere LF, Sokol NS, Dubrovsky EB, Berger EM, Ambros V"
    "Dev Biol (2003) 259:9-18

  3. PubMed ID: 12919683
    The small RNA profile during Drosophila melanogaster development
    "Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T"
    "Dev Cell (2003) 5:337-350

  4. PubMed ID: 17989254
    Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs
    "Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC"
    "Genome Res (2007) 17:1850-1864

  5. PubMed ID: 17989255
    Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes
    "Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M"
    "Genome Res (2007) 17:1865-1879