WARNING: This summary was generated by AI. MIR1-2 is a microRNA that, when overexpressed in bone marrow stromal cells (BMSCs), has been shown to steer these cells towards cardiomyocyte differentiation by activating the Wnt/β-catenin signaling pathway [PMC5424345]. This differentiation process is more effective and exhibits lower cytotoxicity when compared to the use of 5-azacytidine, a chemical that induces DNA demethylation [PMC5424345]. The study utilized copy number assays for MIR1-2 and other genes involved in the cell cycle regulation to confirm these findings [PMC7083839].
a c AC ug aca ccuacu agaguACAUACUUCUUUAUGU CCAUa a u |||||| ||||||||||||||||||||| ||||| | ggaugg uuuUAUGUAUGAAGAAAUGUA GGUau u a c u -A cg aac
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0060794 |
| Description | Homo sapiens hsa-miR-1-2-5p mature miRNA |
| Sequence | 14 - ACAUACUUCUUUAUGUACCCAU - 35 |
| Evidence |
experimental
cloned [2], Illumina [3] |
| Accession | MIMAT0000416 |
| Description | Homo sapiens hsa-miR-1-2-3p mature miRNA |
| Sequence | 53 - UGGAAUGUAAAGAAGUAUGUAU - 74 |
| Evidence |
experimental
cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
|