miRBase entry: hsa-mir-15b

Stem-loop hsa-mir-15b


Accession
MI0000438
Symbol
HGNC: MIR15B
Description
Homo sapiens hsa-mir-15b precursor miRNA mir-15
Gene
family?
RF00455; mir-15

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-15b is a microRNA (miRNA) that has been identified in CD34+ hematopoietic stem cells (HSCs) and is known to play a role in the regulation of gene expression [PMC4669904]. Research has demonstrated that there is an inverse relationship between the expression levels of hsa-mir-15b and the gene Sall4, which suggests that hsa-mir-15b may be involved in the modulation of Sall4 expression within these cells [PMC4669904]. In terms of diagnostic potential, hsa-mir-15b has an area under the receiver operating characteristic (ROC) curve of 0.726, indicating a moderate level of accuracy for distinguishing between different states or conditions in CD34+ HSCs [PMC9279521].

Literature search
405 open access papers mention hsa-mir-15b
(1510 sentences)

Sequence

476877 reads, 5285 reads per million, 129 experiments
uugaggccuuaaaguacugUAGCAGCACAUCAUGGUUUACAugcuacagucaagaugCGAAUCAUUAUUUGCUGCUCUAgaaauuuaaggaaauucau
.((((.(((((((...(((.(((((((.((.(((((((.(((.((.......))))).))))))).)).))))))).)))...)))))))...)))).

Structure
u    --g       gua   U       C  C       A   g  ac 
 ugag   ccuuaaa   cug AGCAGCA AU AUGGUUU CAu cu  a
 ||||   |||||||   ||| ||||||| || ||||||| ||| ||  g
 acuu   ggaauuu   gAU UCGUCGU UA UACUAAG gua ga  u
u    aaa       aaa   C       U  U       C   -  ac 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-15b in human [2].

Genome context
chr3: 160404588-160404685 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-15b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-15b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-15b-5p

Accession MIMAT0000417
Description Homo sapiens hsa-miR-15b-5p mature miRNA
Sequence 20 - UAGCAGCACAUCAUGGUUUACA - 41
Evidence experimental
cloned [2-5]
Database links
Predicted targets

Mature hsa-miR-15b-3p

Accession MIMAT0004586
Description Homo sapiens hsa-miR-15b-3p mature miRNA
Sequence 58 - CGAAUCAUUAUUUGCUGCUCUA - 79
Evidence experimental
cloned [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739