Hsa-mir-15b is a microRNA that has been studied in relation to its expression in CD34+ HSCs [PMC4669904]. One study found that the expression of Sall4, a transcription factor, was inversely correlated with the expression of hsa-mir-15b and hsa-miR-219-5p in CD34+ HSCs [PMC4669904]. Another study evaluated the performance of different miRNAs as potential biomarkers and found that hsa-mir-15b had an area under the ROC curve (AUROC) of 0.726 [PMC9279521]. The AUROC is a measure of how well a biomarker can distinguish between different groups, with values closer to 1 indicating better performance [PMC9279521]. The study also reported AUROC values for other miRNAs, such as hsa-mir-200c (0.784), hsa-mir-141 (0.894), and hsa-mir-16-2 (0.752) [PMC9279521]. These findings suggest that hsa-mir-15b may play a role in regulating gene expression in CD34+ HSCs and could potentially be used as a biomarker for certain conditions or diseases [PMC4669904] [PMC9279521]. However, further research is needed to fully understand its function and potential clinical applications [PMC4669904] [PMC9279521].
u --g gua U C C A g ac ugag ccuuaaa cug AGCAGCA AU AUGGUUU CAu cu a |||| ||||||| ||| ||||||| || ||||||| ||| || g acuu ggaauuu gAU UCGUCGU UA UACUAAG gua ga u u aaa aaa C U U C - ac
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000417 |
Description | Homo sapiens hsa-miR-15b-5p mature miRNA |
Sequence | 20 - UAGCAGCACAUCAUGGUUUACA - 41 |
Evidence |
experimental
cloned [2-5] |
Database links | |
Predicted targets |
Accession | MIMAT0004586 |
Description | Homo sapiens hsa-miR-15b-3p mature miRNA |
Sequence | 58 - CGAAUCAUUAUUUGCUGCUCUA - 79 |
Evidence |
experimental
cloned [4-5] |
Database links | |
Predicted targets |
|