Hsa-mir-15b is a microRNA (miRNA) that has been identified in CD34+ hematopoietic stem cells (HSCs) and is known to play a role in the regulation of gene expression [PMC4669904]. Research has demonstrated that there is an inverse relationship between the expression levels of hsa-mir-15b and the gene Sall4, which suggests that hsa-mir-15b may be involved in the modulation of Sall4 expression within these cells [PMC4669904]. In terms of diagnostic potential, hsa-mir-15b has an area under the receiver operating characteristic (ROC) curve of 0.726, indicating a moderate level of accuracy for distinguishing between different states or conditions in CD34+ HSCs [PMC9279521].
u --g gua U C C A g ac ugag ccuuaaa cug AGCAGCA AU AUGGUUU CAu cu a |||| ||||||| ||| ||||||| || ||||||| ||| || g acuu ggaauuu gAU UCGUCGU UA UACUAAG gua ga u u aaa aaa C U U C - ac
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000417 |
| Description | Homo sapiens hsa-miR-15b-5p mature miRNA |
| Sequence | 20 - UAGCAGCACAUCAUGGUUUACA - 41 |
| Evidence |
experimental
cloned [2-5] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004586 |
| Description | Homo sapiens hsa-miR-15b-3p mature miRNA |
| Sequence | 58 - CGAAUCAUUAUUUGCUGCUCUA - 79 |
| Evidence |
experimental
cloned [4-5] |
| Database links |
|
| Predicted targets |
|
|