miRBase entry: hsa-mir-23b

Stem-loop hsa-mir-23b


Accession
MI0000439
Symbol
HGNC: MIR23B
Description
Homo sapiens hsa-mir-23b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. Hsa-mir-23b is a microRNA that has been identified as significantly down-regulated in the saliva of patients diagnosed with Intraductal Papillary Mucinous Neoplasms (IPMN) [PMC5788610]. This preliminary finding suggests that hsa-mir-23b, along with hsa-miR-23a, could potentially serve as a biomarker for IPMN, aiding in the decision-making process for the management of this condition [PMC4486170]. The presence of hsa-mir-23b in saliva offers a non-invasive diagnostic tool, which could be advantageous for patient care and monitoring [PMC4486170]. The down-regulation of hsa-mir-23b contrasts with other microRNAs that were found to be up-regulated in the same study, indicating a possible unique role for hsa-mir-23b in IPMN pathology and its potential utility in distinguishing this condition from others [PMC5788610].

Literature search
292 open access papers mention hsa-mir-23b
(1581 sentences)

Sequence

734220 reads, 3673 reads per million, 135 experiments
cucaggugcucuggcugcuUGGGUUCCUGGCAUGCUGAUUUgugacuuaagauuaaaAUCACAUUGCCAGGGAUUACCACgcaaccacgaccuuggc
.(((((.(.(((((.(((.(((((((((((((((.((((((..............)))))))).))))))))))..))).))).))).)))))))).

Structure
c     u c  -   c   u   --          -  C      gugacu 
 ucagg g uc ugg ugc UGG  GUUCCUGGCA UG UGAUUU      u
 ||||| | || ||| ||| |||  |||||||||| || ||||||       
 gguuc c ag acc acg ACC  UAGGGACCGU AC ACUAaa      a
c     - -  c   a   C   AU          U  -      auuaga 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr9: 95085208-95085304 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from hsa-mir-23b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-23b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-23b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-23b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-23b-5p

Accession MIMAT0004587
Description Homo sapiens hsa-miR-23b-5p mature miRNA
Sequence 20 - UGGGUUCCUGGCAUGCUGAUUU - 41
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-23b-3p

Accession MIMAT0000418
Description Homo sapiens hsa-miR-23b-3p mature miRNA
Sequence 58 - AUCACAUUGCCAGGGAUUACCAC - 80
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739