WARNING: This summary was generated by AI. Hsa-mir-23b is a microRNA that has been identified as significantly down-regulated in the saliva of patients diagnosed with Intraductal Papillary Mucinous Neoplasms (IPMN) [PMC5788610]. This preliminary finding suggests that hsa-mir-23b, along with hsa-miR-23a, could potentially serve as a biomarker for IPMN, aiding in the decision-making process for the management of this condition [PMC4486170]. The presence of hsa-mir-23b in saliva offers a non-invasive diagnostic tool, which could be advantageous for patient care and monitoring [PMC4486170]. The down-regulation of hsa-mir-23b contrasts with other microRNAs that were found to be up-regulated in the same study, indicating a possible unique role for hsa-mir-23b in IPMN pathology and its potential utility in distinguishing this condition from others [PMC5788610].
c u c - c u -- - C gugacu ucagg g uc ugg ugc UGG GUUCCUGGCA UG UGAUUU u ||||| | || ||| ||| ||| |||||||||| || |||||| gguuc c ag acc acg ACC UAGGGACCGU AC ACUAaa a c - - c a C AU U - auuaga
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004587 |
| Description | Homo sapiens hsa-miR-23b-5p mature miRNA |
| Sequence | 20 - UGGGUUCCUGGCAUGCUGAUUU - 41 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000418 |
| Description | Homo sapiens hsa-miR-23b-3p mature miRNA |
| Sequence | 58 - AUCACAUUGCCAGGGAUUACCAC - 80 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
|