miRBase entry: hsa-mir-30b

Stem-loop hsa-mir-30b


Accession
MI0000441
Symbol
HGNC: MIR30B
Description
Homo sapiens hsa-mir-30b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR30B is a microRNA that has been studied in relation to its effect on autophagy. To determine if this effect is specific to H. pylori, researchers conducted a study where they detected MAP1LC3B-II conversion under starvation conditions [PMC3429542]. In normal conditions, transfection with either MIR30B or miR-26a mimic resulted in a significant increase in the expression of the pro-apoptotic CASP3 and APAF1 genes in BT474 wt and BT474r cells, but not in HCC1954 cells [PMC5264595]. The study found that MIR30B and miR-26a mimic increased CASP3 expression with p-values of 0.026 and 0.032 respectively for BT474 wt cells, and p-values of 0.034 and 0.019 respectively for BT474r cells [PMC5264595]. Similarly, MIR30B and miR-26a mimic increased APAF1 expression with p-values of 0.035 and 0.042 respectively for BT474 wt cells, and p-values of 0.041 and 0.034 respectively for BT474r cells [PMC5264595]. However, there was no significant increase in CASP3 or APAF1 expression observed in HCC1954 cells when transfected with either MIR30B or miR-26a mimic [PMC5264595]. These findings suggest that the effect of MIR30B on autophagy may be specific to certain cell types or conditions [PMC3429542] [PMC5264595].

Literature search
398 open access papers mention hsa-mir-30b
(1810 sentences)

Sequence

147792 reads, 938 reads per million, 136 experiments
accaaguuucaguucaUGUAAACAUCCUACACUCAGCUguaauacauggauuggCUGGGAGGUGGAUGUUUACUUCagcugacuugga
.(((((..((((((...((((((((((.((.((((((((............))))))))..))))))))))))...))))))))))).

Structure
a     uu      caU          U  -A        uaaua 
 ccaag  ucaguu   GUAAACAUCC AC  CUCAGCUg     c
 |||||  ||||||   |||||||||| ||  ||||||||      
 gguuc  agucga   CAUUUGUAGG UG  GGGUCggu     a
a     --      CUU          -  GA        uaggu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
chr8: 134800520-134800607 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-30b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature hsa-miR-30b-5p

Accession MIMAT0000420
Description Homo sapiens hsa-miR-30b-5p mature miRNA
Sequence 17 - UGUAAACAUCCUACACUCAGCU - 38
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-30b-3p

Accession MIMAT0004589
Description Homo sapiens hsa-miR-30b-3p mature miRNA
Sequence 55 - CUGGGAGGUGGAUGUUUACUUC - 76
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739