WARNING: This summary was generated by AI. MIR30B is a microRNA that has been studied for its role in cellular processes such as autophagy and apoptosis [PMC3429542; PMC5264595].'>PMC5264595].. The effect of MIR30B on autophagy was investigated under starvation conditions, but there is no specific mention of H. pylori in this context [PMC3429542]. Additionally, the transfection of cells with a MIR30B mimic has been shown to significantly increase the expression of pro-apoptotic genes CASP3 and APAF1 in certain breast cancer cell lines such as BT474 wt and BT474r [PMC5264595]. This effect, however, was not observed in HCC1954 cells, suggesting that MIR30B may have cell type-specific roles in regulating apoptosis-related genes [PMC5264595].
a uu caU U -A uaaua ccaag ucaguu GUAAACAUCC AC CUCAGCUg c ||||| |||||| |||||||||| || |||||||| gguuc agucga CAUUUGUAGG UG GGGUCggu a a -- CUU - GA uaggu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0000420 |
| Description | Homo sapiens hsa-miR-30b-5p mature miRNA |
| Sequence | 17 - UGUAAACAUCCUACACUCAGCU - 38 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004589 |
| Description | Homo sapiens hsa-miR-30b-3p mature miRNA |
| Sequence | 55 - CUGGGAGGUGGAUGUUUACUUC - 76 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|