WARNING: This summary was generated by AI. MIR122, a liver-specific microRNA, plays a crucial role in various hepatic processes, including lipid metabolism and gluconeogenesis, as mediated through HNF-4α [PMC4806913]. It has been implicated in the regulation of c-Met ecto-domain shedding through ADAM10 processing [PMC7352235]'>PMC7352235], and its reduced function is associated with promoter methylation and decreased SOCS3 expression [PMC3434395]. Interestingly, MIR122 is not essential for HAV-RNA replication [PMC7165973], but its levels can influence HCV replication as demonstrated by the inhibitory effect of apigenin on this process [PMC5812025]. The microRNA has been utilized in therapeutic strategies to reduce virus replication by incorporating its target sequence into the 3'UTR of viral genes for liver-specific inhibition [PMC7281331]. MIR122 also shows potential as a biomarker for early detection and monitoring of NAFLD alongside other miRNAs [PMC9738374]. Its expression levels are crucial in cancer management; reduced MIR122 expression can be targeted with arginine deprivation or sorafenib to manage certain HCCs [PMC4480756], while its absence or downregulation is associated with hepatosteatosis, hepatitis, and tumor development resembling HCC in mice and reduced levels in human HCC cell lines [PMC6177563; PMC6504855].. Furthermore, MIR122 has been identified as a potential onco-suppressor molecule beyond hepatic cancer, including non-small cell lung cancer [PMC7352235].
c - GG C ugucu cuuagcag agcugU AGUGUGA AAUGGUGUUUG a |||||||| |||||| ||||||| ||||||||||| ggaucguc ucgAUA UCACACU UUACCGCAAac a c a AA A uauca
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000421 |
| Description | Homo sapiens hsa-miR-122-5p mature miRNA |
| Sequence | 15 - UGGAGUGUGACAAUGGUGUUUG - 36 |
| Evidence |
experimental
cloned [2-3], Northern [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004590 |
| Description | Homo sapiens hsa-miR-122-3p mature miRNA |
| Sequence | 51 - AACGCCAUUAUCACACUAAAUA - 72 |
| Evidence |
experimental
cloned [3] |
|