miRBase entry: hsa-mir-122

Stem-loop hsa-mir-122


Accession
MI0000442
Symbol
HGNC: MIR122
Description
Homo sapiens hsa-mir-122 precursor miRNA mir-122
Gene
family?
RF00684; mir-122

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR122, a liver-specific microRNA, plays a crucial role in various hepatic processes, including lipid metabolism and gluconeogenesis, as mediated through HNF-4α [PMC4806913]. It has been implicated in the regulation of c-Met ecto-domain shedding through ADAM10 processing [PMC7352235]'>PMC7352235], and its reduced function is associated with promoter methylation and decreased SOCS3 expression [PMC3434395]. Interestingly, MIR122 is not essential for HAV-RNA replication [PMC7165973], but its levels can influence HCV replication as demonstrated by the inhibitory effect of apigenin on this process [PMC5812025]. The microRNA has been utilized in therapeutic strategies to reduce virus replication by incorporating its target sequence into the 3'UTR of viral genes for liver-specific inhibition [PMC7281331]. MIR122 also shows potential as a biomarker for early detection and monitoring of NAFLD alongside other miRNAs [PMC9738374]. Its expression levels are crucial in cancer management; reduced MIR122 expression can be targeted with arginine deprivation or sorafenib to manage certain HCCs [PMC4480756], while its absence or downregulation is associated with hepatosteatosis, hepatitis, and tumor development resembling HCC in mice and reduced levels in human HCC cell lines [PMC6177563; PMC6504855].. Furthermore, MIR122 has been identified as a potential onco-suppressor molecule beyond hepatic cancer, including non-small cell lung cancer [PMC7352235].

Literature search
562 open access papers mention hsa-mir-122
(3998 sentences)

Sequence

325187 reads, 3777 reads per million, 69 experiments
ccuuagcagagcugUGGAGUGUGACAAUGGUGUUUGugucuaaacuaucaAACGCCAUUAUCACACUAAAUAgcuacugcuaggc
.((((((((((((((..(((((((.(((((((((((............))))))))))).)))))))..)))))).)))))))).

Structure
c        -      GG       C           ugucu 
 cuuagcag agcugU  AGUGUGA AAUGGUGUUUG     a
 |||||||| ||||||  ||||||| |||||||||||      
 ggaucguc ucgAUA  UCACACU UUACCGCAAac     a
c        a      AA       A           uauca 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr18: 58451074-58451158 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-122
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-122 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-122-5p

Accession MIMAT0000421
Description Homo sapiens hsa-miR-122-5p mature miRNA
Sequence 15 - UGGAGUGUGACAAUGGUGUUUG - 36
Evidence experimental
cloned [2-3], Northern [2]
Database links
Predicted targets

Mature hsa-miR-122-3p

Accession MIMAT0004590
Description Homo sapiens hsa-miR-122-3p mature miRNA
Sequence 51 - AACGCCAUUAUCACACUAAAUA - 72
Evidence experimental
cloned [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739