miRBase entry: hsa-mir-130a

Stem-loop hsa-mir-130a


Accession
MI0000448
Symbol
HGNC: MIR130A
Description
Homo sapiens hsa-mir-130a precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR130A is a microRNA that has been identified as one of the miRNAs enriched in extracellular vesicles (EVs) from melanoma cells, which is associated with the metastatic process of this skin cancer [PMC9871288]. Studies have demonstrated that MIR130A plays a significant role in various biological processes, and its inhibition has been linked to positive outcomes in the context of cerebral ischemia [PMC6732937]. Specifically, targeting MIR130A has been shown to decrease blood-brain barrier (BBB) permeability and brain edema while improving neurological functions by influencing the expression of Homeobox1 [PMC6732937]. This suggests that MIR130A could be a potential therapeutic target not only for melanoma metastasis but also for conditions involving cerebral ischemia and BBB integrity [PMC9871288; PMC6732937]..

Literature search
188 open access papers mention hsa-mir-130a
(1154 sentences)

Sequence

162101 reads, 1454 reads per million, 131 experiments
ugcugcuggccagaGCUCUUUUCACAUUGUGCUACUgucugcaccugucacuagCAGUGCAAUGUUAAAAGGGCAUuggccguguagug
.((((((((((((.((((((((.((((((((((.(((...((....))...))).)))))))))).)))))))).))))))).))))).

Structure
u     -       a        C          A   ucu  a 
 gcugc uggccag GCUCUUUU ACAUUGUGCU CUg   gc c
 ||||| ||||||| |||||||| |||||||||| |||   ||  
 ugaug gccgguU CGGGAAAA UGUAACGUGA gau   ug c
g     u       A        U          C   cac  u 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
miR-130a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context
chr11: 57641198-57641286 [+]

Disease association
hsa-mir-130a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-130a-5p

Accession MIMAT0004593
Description Homo sapiens hsa-miR-130a-5p mature miRNA
Sequence 15 - GCUCUUUUCACAUUGUGCUACU - 36
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-130a-3p

Accession MIMAT0000425
Description Homo sapiens hsa-miR-130a-3p mature miRNA
Sequence 55 - CAGUGCAAUGUUAAAAGGGCAU - 76
Evidence experimental
cloned [2-4], Northern [2]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739