miRBase entry: hsa-mir-143

Stem-loop hsa-mir-143


Accession
MI0000459
Symbol
HGNC: MIR143
Description
Homo sapiens hsa-mir-143 precursor miRNA mir-143
Gene
family?
RF00683; mir-143

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR143 is a microRNA that plays a significant role in the regulation of various cellular processes, such as inflammation and apoptosis, particularly in the context of obesity [PMC9687157]. Studies have identified a negative correlation between the levels of MIR143 and the mRNA of pro-inflammatory cytokines like IL1β, IL6, and TNFα in the ovaries of obese individuals [PMC9687157]. This correlation suggests that MIR143 could be involved in the modulation of inflammatory responses that are associated with obesity [PMC9687157]. Moreover, the over-expression of MIR143 has been associated with a decrease in the expression of its predicted target proteins, which include hexokinase 2 (HK2) and the beta-1 adrenergic receptor (ADRB1) [PMC5735881]. These target proteins are known to be involved in metabolic pathways and the cellular response to stress [PMC5735881]. Additionally, an increase in MIR143 levels leads to a lower Bcl-2/Bax ratio, which is indicative of its potential impact on the mechanisms of apoptosis [PMC5735881]. Taken together, these findings suggest that MIR143 could have therapeutic relevance for the treatment of obesity-related inflammation and the metabolic disturbances that accompany it [PMC5735881; PMC9687157]..

Literature search
482 open access papers mention hsa-mir-143
(3462 sentences)

Sequence

11084796 reads, 27646 reads per million, 158 experiments
gcgcagcgcccugucucccagccugaGGUGCAGUGCUGCAUCUCUGGUcaguugggagucUGAGAUGAAGCACUGUAGCUCaggaagagagaaguuguucugcagc
((((((.((....((((.(..((((((.(((((((((.((((((.((((......)).)).)))))).))))))))).))))))..).))))....)).)))).))

Structure
  -    c  ccug    c ag      G         G      U  -  ag 
gc gcag gc    ucuc c  ccugaG UGCAGUGCU CAUCUC GG Uc  u
|| |||| ||    |||| |  |||||| ||||||||| |||||| || ||   
cg cguc ug    agag g  ggaCUC AUGUCACGA GUAGAG cu ag  u
  a    u  uuga    a aa      G         A      U  g  gg 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-143 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2]. miR-143 cloned in [3] has a 1 nt 3' extension (A), which is incompatible with the genome sequence.

Genome context
chr5: 149428918-149429023 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-143
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-143 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-143-5p

Accession MIMAT0004599
Description Homo sapiens hsa-miR-143-5p mature miRNA
Sequence 27 - GGUGCAGUGCUGCAUCUCUGGU - 48
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-143-3p

Accession MIMAT0000435
Description Homo sapiens hsa-miR-143-3p mature miRNA
Sequence 61 - UGAGAUGAAGCACUGUAGCUC - 81
Evidence experimental
cloned [2-3], Illumina [4]
Database links
Predicted targets

References

  1. PubMed ID: 14573789
    Reduced accumulation of specific microRNAs in colorectal neoplasia
    "Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ"
    "Mol Cancer Res (2003) 1:882-891

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 20158877
    Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha
    Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V
    BMC Genomics (2010) 11:S6

  4. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739