WARNING: This summary was generated by AI. MIR143 is a microRNA that plays a significant role in the regulation of various cellular processes, such as inflammation and apoptosis, particularly in the context of obesity [PMC9687157]. Studies have identified a negative correlation between the levels of MIR143 and the mRNA of pro-inflammatory cytokines like IL1β, IL6, and TNFα in the ovaries of obese individuals [PMC9687157]. This correlation suggests that MIR143 could be involved in the modulation of inflammatory responses that are associated with obesity [PMC9687157]. Moreover, the over-expression of MIR143 has been associated with a decrease in the expression of its predicted target proteins, which include hexokinase 2 (HK2) and the beta-1 adrenergic receptor (ADRB1) [PMC5735881]. These target proteins are known to be involved in metabolic pathways and the cellular response to stress [PMC5735881]. Additionally, an increase in MIR143 levels leads to a lower Bcl-2/Bax ratio, which is indicative of its potential impact on the mechanisms of apoptosis [PMC5735881]. Taken together, these findings suggest that MIR143 could have therapeutic relevance for the treatment of obesity-related inflammation and the metabolic disturbances that accompany it [PMC5735881; PMC9687157]..
- c ccug c ag G G U - ag gc gcag gc ucuc c ccugaG UGCAGUGCU CAUCUC GG Uc u || |||| || |||| | |||||| ||||||||| |||||| || || cg cguc ug agag g ggaCUC AUGUCACGA GUAGAG cu ag u a u uuga a aa G A U g gg
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004599 |
| Description | Homo sapiens hsa-miR-143-5p mature miRNA |
| Sequence | 27 - GGUGCAGUGCUGCAUCUCUGGU - 48 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0000435 |
| Description | Homo sapiens hsa-miR-143-3p mature miRNA |
| Sequence | 61 - UGAGAUGAAGCACUGUAGCUC - 81 |
| Evidence |
experimental
cloned [2-3], Illumina [4] |
| Database links |
|
| Predicted targets |
|
|