Stem-loop hsa-mir-191

Accession

MI0000465

Symbol

HGNC: MIR191

Description

Homo sapiens hsa-mir-191 precursor miRNA mir-191

Gene
family

RF00764; mir-191

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR191 is a miRNA that has been found to have concentrations in patients with MHT, and it can provide additional information to improve indications for the need for an initial CCT scan [PMC7430915]. In a study, 36 miRNA orthologs were found to be mutually abundant between tumor types, and among them, MIR191 was one of the most notably expressed miRNA orthologs [PMC9210832]. The study used a circular heatmap in Figure-1 to present the expression levels of these miRNA orthologs [PMC9210832]. Additionally, four MEPNA for MIR191 were prepared with varying gap sizes (1-4 consecutive unmodified nucleotide units), with Amir-0 being an unmodified AO [PMC4005664]. These findings suggest that MIR191 is an important miRNA in the context of tumor types and can potentially be used as a biomarker for diagnostic purposes. Further research is needed to fully understand the role of MIR191 in these contexts.

Literature search

166 open access papers mention hsa-mir-191
(853 sentences)

Sequence

1515639 reads, 8115 reads per million, 146 experiments

cggcuggacagcgggCAACGGAAUCCCAAAAGCAGCUGuugucuccagagcauuccaGCUGCGCUUGGAUUUCGUCCCCugcucuccugccu
.(((.(((.((((((..(((((((((.((..(((((((.(((.......)))...)))))))..)))))))))))..)))))).))).))).

Structure

c   u   c      CA         C  AA       --u   cu 
 ggc gga agcggg  ACGGAAUCC AA  GCAGCUG   ugu  c
 ||| ||| ||||||  ||||||||| ||  |||||||   |||  c
 ccg ccu ucguCC  UGCUUUAGG UU  CGUCGac   acg  a
u   u   c      CC         -  CG       cuu   ag 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed in human HL-60 leukemia cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

chr3: 49020618-49020709 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-191

Disease association

hsa-mir-191 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-191-5p

• Accession: MIMAT0000440
• Description: Homo sapiens hsa-miR-191-5p mature miRNA
• Sequence: 16 - CAACGGAAUCCCAAAAGCAGCUG - 38
• Evidence: experimental ; cloned [2-5]

Mature hsa-miR-191-3p

• Accession: MIMAT0001618
• Description: Homo sapiens hsa-miR-191-3p mature miRNA
• Sequence: 58 - GCUGCGCUUGGAUUUCGUCCCC - 79
• Evidence: experimental ; cloned [2-4]

References

1. PubMed ID: 15325244
   Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
   "Kasashima K, Nakamura Y, Kozu T"
   "Biochem Biophys Res Commun (2004) 322:403-410


2. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


3. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


4. PubMed ID: 12554859
   New microRNAs from mouse and human
   "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
   "RNA (2003) 9:175-179


5. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706