Stem-loop hsa-mir-138-1

Accession

MI0000476

Symbol

HGNC: MIR138-1

Description

Homo sapiens hsa-mir-138-1 precursor miRNA mir-138

Gene
family

RF00671; mir-138

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR138-1 is a microRNA that has been studied in various contexts [PMC4468152]. It has been found that there is no overt SC differentiation deficit in MIR138-1 cKO nerves [PMC5830491]. Mendelian randomization analysis has identified DNA methylation levels of two CpGs in the transcription activator DLX2 and micro-RNA MIR138-1, which may have causal effects on iCHD [PMC8501606]. Additionally, two CpGs near DLX2 and MIR138-1 have been identified with putative causal effects on iCHD [PMC8501606]. MIR138-1 is one of the brain-enriched microRNA-coding lncRNAs, along with precursors for MIR4500, MIR2113, MIR137, MIR548N, and MIR9-3 [PMC4468152]. The miRBase database provides information on the genes for both MIR138-1 and its homologous gene, MIR138-2 [PMC7376782]. In a study comparing brain regions, it was found that the expression of several miRNAs including MIR656, MIR29B2CHG, and ENSSTOG00000034702 decreased significantly in LT and Ar compared to IBA [PMC7848201]. This also included a decrease in expression of miR101-1 and ENSSTOG00000034702 [PMC7848201]. The genomic context of several abundant microRNAs including let7b and mir26b was explored to determine if it influenced their accumulation [PMC4057207]. It was found that let7b and mir26b displayed clusters of adenylation for mMtr4KD [PMC4057207].

Literature search

228 open access papers mention hsa-mir-138-1
(1564 sentences)

Sequence

87543 reads, 800 reads per million, 83 experiments

cccuggcauggugugguggggcAGCUGGUGUUGUGAAUCAGGCCGuugccaaucagagaacgGCUACUUCACAACACCAGGGCCacaccacacuacagg
.((((...((((((((((.(((..(((((((((((((...(((((((..(.....)..)))))))..))))))))))))).))).))))))))))))))

Structure

c    gca          g   AG             UCA       gc a 
 ccug   ugguguggug ggc  CUGGUGUUGUGAA   GGCCGuu  c a
 ||||   |||||||||| |||  |||||||||||||   |||||||  | u
 ggac   aucacaccac CCG  GACCACAACACUU   UCGgcaa  g c
-    ---          a   -G             -CA       ga a 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Expression in human was later validated by cloning [2].

Genome context

chr3: 44114212-44114310 [+]

Disease association

hsa-mir-138-1 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-138-5p

• Accession: MIMAT0000430
• Description: Homo sapiens hsa-miR-138-5p mature miRNA
• Sequence: 23 - AGCUGGUGUUGUGAAUCAGGCCG - 45
• Evidence: experimental ; cloned [2]

Mature hsa-miR-138-1-3p

• Accession: MIMAT0004607
• Description: Homo sapiens hsa-miR-138-1-3p mature miRNA
• Sequence: 63 - GCUACUUCACAACACCAGGGCC - 84
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043