WARNING: This summary was generated by AI. MIR149 is a gene that is situated on chromosome 2 at the 2q37.3 locus and is characterized by a single exon responsible for coding the miR-149 microRNA [PMC9956572]. This gene has been observed to exhibit polymorphisms, which suggests a potential for variability in its function or expression [PMC9956572]. However, the specific mechanisms by which MIR149 modulates the expression of matrix metalloproteinases (MMPs) and cyclin D remain unclear and have been identified as an important area for future research endeavors [PMC5983960]. The influence of MIR149 on the expression of the EphB3 gene in certain colorectal cancer cell lines, such as SW1116 and HCT116, has been noted, but the statement regarding the influence of "Form" is not supported by the provided references and therefore has been omitted from this summary.
g - g U U G G A g g g ccggc gccc agc C G CUCCGU UCUUC CUCCC u cuu u ||||| |||| ||| | | |||||| ||||| ||||| | ||| ggucg cggg uCG G C GGGGCA GGAGG GAggg a gag c a a g U U G G - - g c
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000450 |
| Description | Homo sapiens hsa-miR-149-5p mature miRNA |
| Sequence | 15 - UCUGGCUCCGUGUCUUCACUCCC - 37 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004609 |
| Description | Homo sapiens hsa-miR-149-3p mature miRNA |
| Sequence | 56 - AGGGAGGGACGGGGGCUGUGC - 76 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|