MIR149 is a gene located at 2q37.3, consisting of one exon that codes for MIR149 and exhibits polymorphisms [PMC9956572]. The expression of miR-149 and the EphB3 gene in SW1116 and HCT116 cells is influenced by Form [PMC5983960]. However, the mechanism by which MIR149 regulates the expression of MMP and cyclin D remains unknown, requiring further investigation [PMC5983960].
g - g U U G G A g g g ccggc gccc agc C G CUCCGU UCUUC CUCCC u cuu u ||||| |||| ||| | | |||||| ||||| ||||| | ||| ggucg cggg uCG G C GGGGCA GGAGG GAggg a gag c a a g U U G G - - g c
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000450 |
Description | Homo sapiens hsa-miR-149-5p mature miRNA |
Sequence | 15 - UCUGGCUCCGUGUCUUCACUCCC - 37 |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004609 |
Description | Homo sapiens hsa-miR-149-3p mature miRNA |
Sequence | 56 - AGGGAGGGACGGGGGCUGUGC - 76 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|