MIR186 is a microRNA that has been identified as down-regulated in human prostate cancer (PCa) specimens, particularly in metastatic patients [PMC8431208]. Recent research has suggested that MIR186 acts as a metastasis suppressor in PCa [PMC8431208]. Furthermore, MIR186 has been found to play a tumor suppressive role in PCa by inhibiting tumorigenesis and metastasis, with its expression level being inversely correlated with clinical grade and pathological grading [PMC5078081]. Additionally, low expression of MIR186 has been associated with poor patient survival [PMC5078081]. Correlation analyses have revealed a positive correlation between miR25 and IL-12, while no significant correlations were found between miR21 and IL-21 or MIR186 and IL-12 [PMC9013931]. The role of the long non-coding RNA (lncRNA) PVT1 in regulating the expression of MIR186 has been demonstrated using lncRNA PVT1 silenced cholangiocarcinoma (CCA) cell lines [PMC8286192]. Overall, these findings highlight the importance of MIR186 as a potential therapeutic target for PCa due to its involvement in metastasis suppression and tumor suppression.
u u U U ucuggu gcuug aacuuucCAAAGAAUUC CCUUU GGGCUu u ||||| ||||||||||||||||| ||||| |||||| cgagu uugaaGGGUUUUUUAAG GGAAA CCCGaa u u - U - uuuuau
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000456 |
Description | Homo sapiens hsa-miR-186-5p mature miRNA |
Sequence | 15 - CAAAGAAUUCUCCUUUUGGGCU - 36 |
Evidence |
experimental
cloned [1-3] |
Database links | |
Predicted targets |
Accession | MIMAT0004612 |
Description | Homo sapiens hsa-miR-186-3p mature miRNA |
Sequence | 54 - GCCCAAAGGUGAAUUUUUUGGG - 75 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|