WARNING: This summary was generated by AI. MIR186 is identified as a microRNA that exhibits a tumor suppressive role in prostate cancer (PCa), with its down-regulation observed in human PCa specimens, particularly in those from metastatic patients, suggesting its function as a metastasis suppressor [PMC8431208]. The expression level of MIR186 is inversely associated with clinical grade and pathological grading in PCa, and lower levels of MIR186 are linked to reduced survival rates among patients [PMC5078081]. While MIR186 has been implicated in the regulation of Twist1 expression and associated with cisplatin resistance in ovarian cancer, its tumor-suppressive effects in PCa are characterized by the inhibition of tumorigenesis and metastasis [PMC5078081]. Additionally, the study found no significant correlation between MIR186 and IL-12 levels, unlike the positive correlation observed between miR25 and IL-12 [PMC9013931]. The regulation of MIR186 expression by the long non-coding RNA (lncRNA) PVT1 has been demonstrated through experiments involving lncRNA PVT1 silenced cholangiocarcinoma (CCA) cell lines, further elucidating the molecular mechanisms controlling MIR186 levels [PMC8286192].
u u U U ucuggu gcuug aacuuucCAAAGAAUUC CCUUU GGGCUu u ||||| ||||||||||||||||| ||||| |||||| cgagu uugaaGGGUUUUUUAAG GGAAA CCCGaa u u - U - uuuuau
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000456 |
| Description | Homo sapiens hsa-miR-186-5p mature miRNA |
| Sequence | 15 - CAAAGAAUUCUCCUUUUGGGCU - 36 |
| Evidence |
experimental
cloned [1-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004612 |
| Description | Homo sapiens hsa-miR-186-3p mature miRNA |
| Sequence | 54 - GCCCAAAGGUGAAUUUUUUGGG - 75 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|