miRBase entry: hsa-mir-188

Stem-loop hsa-mir-188


Accession
MI0000484
Symbol
HGNC: MIR188
Description
Homo sapiens hsa-mir-188 precursor miRNA mir-188
Gene
family?
RF01897; mir-188

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR188, a microRNA, is significantly up-regulated in aged mice and humans, suggesting a role in the aging process [PMC6158877]. It targets genes such as Hdac9 and Rictor that are implicated in bone metabolism [PMC6158877]. Overexpression of MIR188 in osteoprogenitors of transgenic mice leads to increased bone loss and fat accumulation in the bone marrow with aging, while mice deficient in MIR188 exhibit reduced age-related bone loss and fat accumulation [PMC6158877]. Despite these findings, alterations in the copy number and DNA methylation level at the MIR188 locus are infrequent in stomach adenocarcinoma (STAD) samples [PMC6537442]. Additionally, MIR188 is involved in homocysteine-induced cardiac remodeling [PMC5147974] and has been identified as a key regulator of age-related adipogenesis switch in bone marrow stromal cells (BMSCs) [PMC9391248]. The genomic location of the MIR188 gene has been mapped to approximately 50 kb upstream from the Clcn5 gene on the X-chromosome [PMC5052619], with potential regulatory elements identified upstream of its locus that could influence its expression [PMC6537442].

Literature search
155 open access papers mention hsa-mir-188
(563 sentences)

Sequence

9782 reads, 70.0 reads per million, 136 experiments
ugcucccucucucaCAUCCCUUGCAUGGUGGAGGGUgagcuuucugaaaacccCUCCCACAUGCAGGGUUUGCAggauggcgagcc
.((((((..(((..((..(((((((((..((((((....(.....).....))))))..)))))))))..))..))).)).)))).

Structure
u    -  uc   ca  UC         GU      -Ugag u 
 gcuc cc  ucu  CA  CCUUGCAUG  GGAGGG     c u
 |||| ||  |||  ||  |||||||||  ||||||     | u
 cgag gg  agg  GU  GGGACGUAC  CCUCcc     g c
c    c  -u   AC  UU         AC      caaaa u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chrX: 50003503-50003588 [+]
Clustered miRNAs
6 other miRNAs are < 10 kb from hsa-mir-188
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-188 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-188-5p

Accession MIMAT0000457
Description Homo sapiens hsa-miR-188-5p mature miRNA
Sequence 15 - CAUCCCUUGCAUGGUGGAGGGU - 36
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-188-3p

Accession MIMAT0004613
Description Homo sapiens hsa-miR-188-3p mature miRNA
Sequence 54 - CUCCCACAUGCAGGGUUUGCA - 74
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52